Incidental Mutation 'E0370:Prdm11'
ID206402
Institutional Source Beutler Lab
Gene Symbol Prdm11
Ensembl Gene ENSMUSG00000075028
Gene NamePR domain containing 11
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #E0370 (G1)
Quality Score153
Status Validated
Chromosome2
Chromosomal Location92965151-93046167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92980579 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 225 (Y225C)
Ref Sequence ENSEMBL: ENSMUSP00000136795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111272] [ENSMUST00000111274] [ENSMUST00000178666]
Predicted Effect probably benign
Transcript: ENSMUST00000111272
SMART Domains Protein: ENSMUSP00000106903
Gene: ENSMUSG00000075028

DomainStartEndE-ValueType
SANT 147 217 3.94e-3 SMART
low complexity region 291 312 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111274
AA Change: Y225C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106905
Gene: ENSMUSG00000075028
AA Change: Y225C

DomainStartEndE-ValueType
SET 115 232 5.16e-2 SMART
low complexity region 369 380 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178666
AA Change: Y225C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136795
Gene: ENSMUSG00000075028
AA Change: Y225C

DomainStartEndE-ValueType
SET 115 232 5.16e-2 SMART
low complexity region 369 380 N/A INTRINSIC
Meta Mutation Damage Score 0.9186 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.1%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik TGCAGCGACTGGACGGCGGCA TGCA 11: 70,616,426 probably null Het
Aire T A 10: 78,042,063 N180I probably damaging Het
Asic3 G T 5: 24,413,987 L92F probably damaging Het
Birc6 G A 17: 74,677,357 D4455N probably damaging Het
Cd36 A T 5: 17,785,749 C464* probably null Het
Cdx1 A C 18: 61,020,429 I179S probably damaging Het
D430042O09Rik A G 7: 125,850,302 D846G probably benign Het
Dnah2 A T 11: 69,515,615 probably null Het
Dst A T 1: 34,249,471 probably benign Het
Epb41l3 A G 17: 69,274,804 N580S possibly damaging Het
Hnrnpm A T 17: 33,658,922 probably benign Het
Map2 A T 1: 66,416,724 probably benign Het
Mapk11 T C 15: 89,146,513 D88G probably damaging Het
Marc1 T C 1: 184,795,228 probably benign Het
Mbd4 C T 6: 115,849,155 E271K possibly damaging Het
Mpp4 T G 1: 59,139,758 probably benign Het
Muc2 T C 7: 141,696,355 Y609H probably damaging Het
Olfr918 A T 9: 38,672,561 D307E probably damaging Het
Pex1 T A 5: 3,631,614 probably null Het
Psmc3 T A 2: 91,055,118 probably null Het
Slc26a8 A T 17: 28,642,387 D774E possibly damaging Het
Slc9a2 A T 1: 40,763,541 probably null Het
Smc1b A G 15: 85,127,581 Y168H probably damaging Het
Steap1 T C 5: 5,740,673 R92G probably damaging Het
Tbx22 T C X: 107,685,153 I430T probably benign Het
Tfap4 T A 16: 4,559,470 H16L possibly damaging Het
Tnxb A G 17: 34,678,943 D855G probably damaging Het
Trip13 A G 13: 73,920,439 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r121 A G X: 124,127,920 V801A probably benign Het
Wiz C T 17: 32,355,118 R935Q probably damaging Het
Other mutations in Prdm11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Prdm11 APN 2 93012757 missense probably damaging 1.00
IGL02108:Prdm11 APN 2 92975703 missense probably damaging 1.00
IGL02166:Prdm11 APN 2 93012863 missense probably damaging 1.00
IGL02369:Prdm11 APN 2 92975519 missense probably benign 0.00
IGL02388:Prdm11 APN 2 92975612 missense possibly damaging 0.90
IGL02606:Prdm11 APN 2 92975603 missense probably benign 0.02
IGL02967:Prdm11 APN 2 93012889 missense probably damaging 1.00
IGL03085:Prdm11 APN 2 92974959 missense possibly damaging 0.86
IGL03125:Prdm11 APN 2 92980622 missense probably benign 0.22
R0607:Prdm11 UTSW 2 93013785 missense possibly damaging 0.85
R0964:Prdm11 UTSW 2 92989222 intron probably benign
R4011:Prdm11 UTSW 2 93012830 missense probably damaging 1.00
R4298:Prdm11 UTSW 2 92993383 missense probably benign 0.44
R4951:Prdm11 UTSW 2 92980609 missense probably damaging 1.00
R5150:Prdm11 UTSW 2 92975472 missense probably damaging 1.00
R5320:Prdm11 UTSW 2 93012881 missense probably benign 0.00
R5432:Prdm11 UTSW 2 92975813 missense probably benign 0.00
R6442:Prdm11 UTSW 2 92975645 missense probably benign 0.34
R6754:Prdm11 UTSW 2 93013792 missense probably damaging 1.00
R7403:Prdm11 UTSW 2 92986691 missense probably benign
R7480:Prdm11 UTSW 2 92975324 missense probably benign 0.05
R7497:Prdm11 UTSW 2 93012707 missense possibly damaging 0.93
R7633:Prdm11 UTSW 2 92980654 missense probably damaging 1.00
R7873:Prdm11 UTSW 2 92989283 missense probably benign 0.01
R7936:Prdm11 UTSW 2 92975761 missense possibly damaging 0.67
R7939:Prdm11 UTSW 2 93012729 missense probably damaging 1.00
R8548:Prdm11 UTSW 2 93012758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCGAGTCACTTCACAATC -3'
(R):5'- ACAGCAGCTCTTCTTATGTGC -3'

Sequencing Primer
(F):5'- CAGTACTGACCTAGACTTGTGGAC -3'
(R):5'- GTGCCCACATACTTTAAGCTCTTGTG -3'
Posted On2014-06-23