Incidental Mutation 'E0370:Steap1'
ID206404
Institutional Source Beutler Lab
Gene Symbol Steap1
Ensembl Gene ENSMUSG00000015652
Gene Namesix transmembrane epithelial antigen of the prostate 1
Synonyms2410007B19Rik, Prss24
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #E0370 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location5736317-5749326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5740673 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 92 (R92G)
Ref Sequence ENSEMBL: ENSMUSP00000015796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015796]
Predicted Effect probably damaging
Transcript: ENSMUST00000015796
AA Change: R92G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015796
Gene: ENSMUSG00000015652
AA Change: R92G

DomainStartEndE-ValueType
Pfam:Ferric_reduct 118 264 2e-17 PFAM
transmembrane domain 289 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169542
SMART Domains Protein: ENSMUSP00000126005
Gene: ENSMUSG00000015652

DomainStartEndE-ValueType
Pfam:Ferric_reduct 10 77 2.7e-10 PFAM
Meta Mutation Damage Score 0.7961 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.1%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in prostate tissue, and is found to be upregulated in multiple cancer cell lines. The gene product is predicted to be a six-transmembrane protein, and was shown to be a cell surface antigen significantly expressed at cell-cell junctions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik TGCAGCGACTGGACGGCGGCA TGCA 11: 70,616,426 probably null Het
Aire T A 10: 78,042,063 N180I probably damaging Het
Asic3 G T 5: 24,413,987 L92F probably damaging Het
Birc6 G A 17: 74,677,357 D4455N probably damaging Het
Cd36 A T 5: 17,785,749 C464* probably null Het
Cdx1 A C 18: 61,020,429 I179S probably damaging Het
D430042O09Rik A G 7: 125,850,302 D846G probably benign Het
Dnah2 A T 11: 69,515,615 probably null Het
Dst A T 1: 34,249,471 probably benign Het
Epb41l3 A G 17: 69,274,804 N580S possibly damaging Het
Hnrnpm A T 17: 33,658,922 probably benign Het
Map2 A T 1: 66,416,724 probably benign Het
Mapk11 T C 15: 89,146,513 D88G probably damaging Het
Marc1 T C 1: 184,795,228 probably benign Het
Mbd4 C T 6: 115,849,155 E271K possibly damaging Het
Mpp4 T G 1: 59,139,758 probably benign Het
Muc2 T C 7: 141,696,355 Y609H probably damaging Het
Olfr918 A T 9: 38,672,561 D307E probably damaging Het
Pex1 T A 5: 3,631,614 probably null Het
Prdm11 T C 2: 92,980,579 Y225C probably damaging Het
Psmc3 T A 2: 91,055,118 probably null Het
Slc26a8 A T 17: 28,642,387 D774E possibly damaging Het
Slc9a2 A T 1: 40,763,541 probably null Het
Smc1b A G 15: 85,127,581 Y168H probably damaging Het
Tbx22 T C X: 107,685,153 I430T probably benign Het
Tfap4 T A 16: 4,559,470 H16L possibly damaging Het
Tnxb A G 17: 34,678,943 D855G probably damaging Het
Trip13 A G 13: 73,920,439 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r121 A G X: 124,127,920 V801A probably benign Het
Wiz C T 17: 32,355,118 R935Q probably damaging Het
Other mutations in Steap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02492:Steap1 APN 5 5740561 missense possibly damaging 0.87
PIT4468001:Steap1 UTSW 5 5736642 missense probably damaging 0.98
R0087:Steap1 UTSW 5 5736664 missense probably damaging 1.00
R0281:Steap1 UTSW 5 5736431 missense probably benign
R0525:Steap1 UTSW 5 5742903 missense possibly damaging 0.65
R0834:Steap1 UTSW 5 5740357 missense probably damaging 0.98
R1665:Steap1 UTSW 5 5736498 missense probably damaging 1.00
R1941:Steap1 UTSW 5 5740541 missense probably damaging 1.00
R4808:Steap1 UTSW 5 5738829 intron probably benign
R4860:Steap1 UTSW 5 5736589 missense probably damaging 1.00
R4860:Steap1 UTSW 5 5736589 missense probably damaging 1.00
R5004:Steap1 UTSW 5 5742829 nonsense probably null
R5138:Steap1 UTSW 5 5736486 missense probably damaging 0.99
R5330:Steap1 UTSW 5 5740422 missense probably damaging 1.00
R5583:Steap1 UTSW 5 5740579 missense possibly damaging 0.93
R6273:Steap1 UTSW 5 5740827 missense possibly damaging 0.65
R8342:Steap1 UTSW 5 5740816 missense probably benign
R8478:Steap1 UTSW 5 5736432 missense probably benign 0.30
R8850:Steap1 UTSW 5 5740838 missense probably benign 0.01
R8949:Steap1 UTSW 5 5739940 missense probably damaging 0.99
Z1177:Steap1 UTSW 5 5739882 missense probably damaging 0.98
Z1177:Steap1 UTSW 5 5740580 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GTACTTGGTTCCATTGCGAAG -3'
(R):5'- AAATCCCATGCTTTGTCCAGTG -3'

Sequencing Primer
(F):5'- GAAGCTGTACAACTGCCGC -3'
(R):5'- CTTTCGTAGACTAAGGACTCGG -3'
Posted On2014-06-23