Incidental Mutation 'E0370:Cd36'
ID 206405
Institutional Source Beutler Lab
Gene Symbol Cd36
Ensembl Gene ENSMUSG00000002944
Gene Name CD36 molecule
Synonyms fatty acid translocase, FAT, Scarb3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # E0370 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 17781690-17888801 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 17785749 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 464 (C464*)
Ref Sequence ENSEMBL: ENSMUSP00000143061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082367] [ENSMUST00000165232] [ENSMUST00000169095] [ENSMUST00000170051] [ENSMUST00000197890]
AlphaFold Q08857
Predicted Effect probably null
Transcript: ENSMUST00000082367
AA Change: C464*
SMART Domains Protein: ENSMUSP00000080974
Gene: ENSMUSG00000002944
AA Change: C464*

Pfam:CD36 14 463 2.5e-151 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165232
AA Change: C464*
SMART Domains Protein: ENSMUSP00000126300
Gene: ENSMUSG00000002944
AA Change: C464*

Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169095
AA Change: C464*
SMART Domains Protein: ENSMUSP00000131832
Gene: ENSMUSG00000002944
AA Change: C464*

Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170051
AA Change: C464*
SMART Domains Protein: ENSMUSP00000133008
Gene: ENSMUSG00000002944
AA Change: C464*

Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197890
AA Change: C464*
SMART Domains Protein: ENSMUSP00000143061
Gene: ENSMUSG00000002944
AA Change: C464*

Pfam:CD36 12 465 2.5e-149 PFAM
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.1%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik TGCAGCGACTGGACGGCGGCA TGCA 11: 70,616,426 probably null Het
Aire T A 10: 78,042,063 N180I probably damaging Het
Asic3 G T 5: 24,413,987 L92F probably damaging Het
Birc6 G A 17: 74,677,357 D4455N probably damaging Het
Cdx1 A C 18: 61,020,429 I179S probably damaging Het
D430042O09Rik A G 7: 125,850,302 D846G probably benign Het
Dnah2 A T 11: 69,515,615 probably null Het
Dst A T 1: 34,249,471 probably benign Het
Epb41l3 A G 17: 69,274,804 N580S possibly damaging Het
Hnrnpm A T 17: 33,658,922 probably benign Het
Map2 A T 1: 66,416,724 probably benign Het
Mapk11 T C 15: 89,146,513 D88G probably damaging Het
Marc1 T C 1: 184,795,228 probably benign Het
Mbd4 C T 6: 115,849,155 E271K possibly damaging Het
Mpp4 T G 1: 59,139,758 probably benign Het
Muc2 T C 7: 141,696,355 Y609H probably damaging Het
Olfr918 A T 9: 38,672,561 D307E probably damaging Het
Pex1 T A 5: 3,631,614 probably null Het
Prdm11 T C 2: 92,980,579 Y225C probably damaging Het
Psmc3 T A 2: 91,055,118 probably null Het
Slc26a8 A T 17: 28,642,387 D774E possibly damaging Het
Slc9a2 A T 1: 40,763,541 probably null Het
Smc1b A G 15: 85,127,581 Y168H probably damaging Het
Steap1 T C 5: 5,740,673 R92G probably damaging Het
Tbx22 T C X: 107,685,153 I430T probably benign Het
Tfap4 T A 16: 4,559,470 H16L possibly damaging Het
Tnxb A G 17: 34,678,943 D855G probably damaging Het
Trip13 A G 13: 73,920,439 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r121 A G X: 124,127,920 V801A probably benign Het
Wiz C T 17: 32,355,118 R935Q probably damaging Het
Other mutations in Cd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Cd36 APN 5 17787702 missense probably damaging 0.99
IGL01355:Cd36 APN 5 17813074 missense possibly damaging 0.76
IGL02140:Cd36 APN 5 17828768 splice site probably benign
IGL02385:Cd36 APN 5 17814719 missense probably benign 0.31
IGL02626:Cd36 APN 5 17797128 nonsense probably null
IGL02645:Cd36 APN 5 17785880 missense probably benign 0.01
IGL03149:Cd36 APN 5 17820565 missense probably benign 0.02
detached UTSW 5 17814723 missense probably damaging 1.00
oblivious UTSW 5 17874966 intron probably benign
F5770:Cd36 UTSW 5 17820528 frame shift probably null
R0266:Cd36 UTSW 5 17798252 missense probably benign 0.09
R1102:Cd36 UTSW 5 17814213 missense possibly damaging 0.79
R1120:Cd36 UTSW 5 17785828 missense possibly damaging 0.67
R1170:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R1551:Cd36 UTSW 5 17797122 missense probably benign 0.00
R1918:Cd36 UTSW 5 17797036 nonsense probably null
R4090:Cd36 UTSW 5 17785720 critical splice donor site probably null
R4197:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R5602:Cd36 UTSW 5 17814792 missense possibly damaging 0.94
R5647:Cd36 UTSW 5 17814765 missense probably damaging 1.00
R5867:Cd36 UTSW 5 17785735 missense probably benign 0.05
R6151:Cd36 UTSW 5 17795595 missense probably damaging 1.00
R6400:Cd36 UTSW 5 17814723 missense probably damaging 1.00
R6419:Cd36 UTSW 5 17797152 missense probably benign
R7081:Cd36 UTSW 5 17814704 missense probably damaging 1.00
R7195:Cd36 UTSW 5 17814189 missense probably damaging 1.00
R7420:Cd36 UTSW 5 17788274 missense probably benign 0.09
R8677:Cd36 UTSW 5 17820495 missense probably damaging 1.00
R9460:Cd36 UTSW 5 17795610 missense probably null 0.10
R9526:Cd36 UTSW 5 17797035 missense probably damaging 0.99
V7580:Cd36 UTSW 5 17820528 frame shift probably null
Z1088:Cd36 UTSW 5 17795575 splice site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-06-23