Incidental Mutation 'E0370:Tfap4'
ID206419
Institutional Source Beutler Lab
Gene Symbol Tfap4
Ensembl Gene ENSMUSG00000005718
Gene Nametranscription factor AP4
SynonymsAP-4, bHLHc41, Tcfap4
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #E0370 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4544661-4559854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4559470 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 16 (H16L)
Ref Sequence ENSEMBL: ENSMUSP00000005862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005862] [ENSMUST00000230875]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005862
AA Change: H16L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005862
Gene: ENSMUSG00000005718
AA Change: H16L

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
HLH 54 105 2.06e-16 SMART
coiled coil region 144 183 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230875
Meta Mutation Damage Score 0.1818 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.1%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription factors of the basic helix-loop-helix-zipper (bHLH-ZIP) family contain a basic domain, which is used for DNA binding, and HLH and ZIP domains, which are used for oligomerization. Transcription factor AP4 activates both viral and cellular genes by binding to the symmetrical DNA sequence CAGCTG (Mermod et al., 1988 [PubMed 2833704]; Hu et al., 1990 [PubMed 2123466]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality and reduced suppression of Cd4 in double negative thymocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik TGCAGCGACTGGACGGCGGCA TGCA 11: 70,616,426 probably null Het
Aire T A 10: 78,042,063 N180I probably damaging Het
Asic3 G T 5: 24,413,987 L92F probably damaging Het
Birc6 G A 17: 74,677,357 D4455N probably damaging Het
Cd36 A T 5: 17,785,749 C464* probably null Het
Cdx1 A C 18: 61,020,429 I179S probably damaging Het
D430042O09Rik A G 7: 125,850,302 D846G probably benign Het
Dnah2 A T 11: 69,515,615 probably null Het
Dst A T 1: 34,249,471 probably benign Het
Epb41l3 A G 17: 69,274,804 N580S possibly damaging Het
Hnrnpm A T 17: 33,658,922 probably benign Het
Map2 A T 1: 66,416,724 probably benign Het
Mapk11 T C 15: 89,146,513 D88G probably damaging Het
Marc1 T C 1: 184,795,228 probably benign Het
Mbd4 C T 6: 115,849,155 E271K possibly damaging Het
Mpp4 T G 1: 59,139,758 probably benign Het
Muc2 T C 7: 141,696,355 Y609H probably damaging Het
Olfr918 A T 9: 38,672,561 D307E probably damaging Het
Pex1 T A 5: 3,631,614 probably null Het
Prdm11 T C 2: 92,980,579 Y225C probably damaging Het
Psmc3 T A 2: 91,055,118 probably null Het
Slc26a8 A T 17: 28,642,387 D774E possibly damaging Het
Slc9a2 A T 1: 40,763,541 probably null Het
Smc1b A G 15: 85,127,581 Y168H probably damaging Het
Steap1 T C 5: 5,740,673 R92G probably damaging Het
Tbx22 T C X: 107,685,153 I430T probably benign Het
Tnxb A G 17: 34,678,943 D855G probably damaging Het
Trip13 A G 13: 73,920,439 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r121 A G X: 124,127,920 V801A probably benign Het
Wiz C T 17: 32,355,118 R935Q probably damaging Het
Other mutations in Tfap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Tfap4 APN 16 4547359 missense probably damaging 1.00
IGL01816:Tfap4 APN 16 4552092 missense probably damaging 0.98
IGL02947:Tfap4 APN 16 4551360 missense probably damaging 0.99
R1311:Tfap4 UTSW 16 4559426 critical splice donor site probably null
R1791:Tfap4 UTSW 16 4552069 missense possibly damaging 0.53
R4300:Tfap4 UTSW 16 4551360 missense probably damaging 0.99
R4371:Tfap4 UTSW 16 4551999 missense probably damaging 1.00
R5945:Tfap4 UTSW 16 4545629 missense possibly damaging 0.53
R6219:Tfap4 UTSW 16 4547311 missense probably damaging 0.96
R6738:Tfap4 UTSW 16 4549447 missense probably damaging 0.99
R7678:Tfap4 UTSW 16 4551766 missense possibly damaging 0.53
R8496:Tfap4 UTSW 16 4551306 missense probably damaging 0.99
R8854:Tfap4 UTSW 16 4549374 missense probably benign 0.03
X0065:Tfap4 UTSW 16 4547276 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCAGTAGCTAAGAAAGGCG -3'
(R):5'- TTTCCCGCCTTGAAACAGAC -3'

Sequencing Primer
(F):5'- CTAAGAAAGGCGAGCGAGCTC -3'
(R):5'- CTTGAAACAGACATCTGATCAGCTG -3'
Posted On2014-06-23