Incidental Mutation 'E0370:Cdx1'
ID206426
Institutional Source Beutler Lab
Gene Symbol Cdx1
Ensembl Gene ENSMUSG00000024619
Gene Namecaudal type homeobox 1
SynonymsCdx-1, Cdx
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #E0370 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location61018862-61036199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 61020429 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 179 (I179S)
Ref Sequence ENSEMBL: ENSMUSP00000025521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025521]
Predicted Effect probably damaging
Transcript: ENSMUST00000025521
AA Change: I179S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025521
Gene: ENSMUSG00000024619
AA Change: I179S

DomainStartEndE-ValueType
Pfam:Caudal_act 13 146 4.8e-31 PFAM
HOX 154 216 1.3e-25 SMART
low complexity region 217 246 N/A INTRINSIC
Meta Mutation Damage Score 0.8200 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.1%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the caudal-related homeobox transcription factor gene family. The encoded DNA-binding protein regulates intestine-specific gene expression and enterocyte differentiation. It has been shown to induce expression of the intestinal alkaline phosphatase gene, and inhibit beta-catenin/T-cell factor transcriptional activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in abnormalities of the basiocciptal bone, vertebrae, and ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik TGCAGCGACTGGACGGCGGCA TGCA 11: 70,616,426 probably null Het
Aire T A 10: 78,042,063 N180I probably damaging Het
Asic3 G T 5: 24,413,987 L92F probably damaging Het
Birc6 G A 17: 74,677,357 D4455N probably damaging Het
Cd36 A T 5: 17,785,749 C464* probably null Het
D430042O09Rik A G 7: 125,850,302 D846G probably benign Het
Dnah2 A T 11: 69,515,615 probably null Het
Dst A T 1: 34,249,471 probably benign Het
Epb41l3 A G 17: 69,274,804 N580S possibly damaging Het
Hnrnpm A T 17: 33,658,922 probably benign Het
Map2 A T 1: 66,416,724 probably benign Het
Mapk11 T C 15: 89,146,513 D88G probably damaging Het
Marc1 T C 1: 184,795,228 probably benign Het
Mbd4 C T 6: 115,849,155 E271K possibly damaging Het
Mpp4 T G 1: 59,139,758 probably benign Het
Muc2 T C 7: 141,696,355 Y609H probably damaging Het
Olfr918 A T 9: 38,672,561 D307E probably damaging Het
Pex1 T A 5: 3,631,614 probably null Het
Prdm11 T C 2: 92,980,579 Y225C probably damaging Het
Psmc3 T A 2: 91,055,118 probably null Het
Slc26a8 A T 17: 28,642,387 D774E possibly damaging Het
Slc9a2 A T 1: 40,763,541 probably null Het
Smc1b A G 15: 85,127,581 Y168H probably damaging Het
Steap1 T C 5: 5,740,673 R92G probably damaging Het
Tbx22 T C X: 107,685,153 I430T probably benign Het
Tfap4 T A 16: 4,559,470 H16L possibly damaging Het
Tnxb A G 17: 34,678,943 D855G probably damaging Het
Trip13 A G 13: 73,920,439 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r121 A G X: 124,127,920 V801A probably benign Het
Wiz C T 17: 32,355,118 R935Q probably damaging Het
Other mutations in Cdx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Cdx1 UTSW 18 61019881 small insertion probably benign
FR4737:Cdx1 UTSW 18 61019874 small insertion probably benign
FR4737:Cdx1 UTSW 18 61019878 small insertion probably benign
FR4976:Cdx1 UTSW 18 61019867 small insertion probably benign
FR4976:Cdx1 UTSW 18 61019869 small insertion probably benign
R0218:Cdx1 UTSW 18 61020364 splice site probably benign
R0481:Cdx1 UTSW 18 61020492 missense probably damaging 1.00
R1776:Cdx1 UTSW 18 61036014 missense probably benign 0.01
R1914:Cdx1 UTSW 18 61019898 missense probably benign 0.01
R1915:Cdx1 UTSW 18 61019898 missense probably benign 0.01
R2094:Cdx1 UTSW 18 61035912 missense possibly damaging 0.85
R4191:Cdx1 UTSW 18 61020438 missense possibly damaging 0.88
R5671:Cdx1 UTSW 18 61019899 missense probably benign 0.01
R8145:Cdx1 UTSW 18 61019923 missense probably damaging 1.00
RF036:Cdx1 UTSW 18 61019870 small insertion probably benign
RF038:Cdx1 UTSW 18 61019870 small insertion probably benign
RF039:Cdx1 UTSW 18 61019870 small insertion probably benign
RF040:Cdx1 UTSW 18 61019870 small insertion probably benign
RF049:Cdx1 UTSW 18 61019866 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATTACCAGCCACTGTAGCCC -3'
(R):5'- TTTCAGTCAGGCGCTGTCTG -3'

Sequencing Primer
(F):5'- CACTGTAGCCCGTGGTATG -3'
(R):5'- AGGCGCTGTCTGGTCCTTC -3'
Posted On2014-06-23