Incidental Mutation 'R1822:Hmcn2'
ID206435
Institutional Source Beutler Lab
Gene Symbol Hmcn2
Ensembl Gene ENSMUSG00000055632
Gene Namehemicentin 2
Synonyms
MMRRC Submission 039850-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1822 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31314415-31460738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31383692 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1352 (S1352L)
Ref Sequence ENSEMBL: ENSMUSP00000154649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]
Predicted Effect probably damaging
Transcript: ENSMUST00000113532
AA Change: S1352L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632
AA Change: S1352L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 37 211 1.21e-1 SMART
Blast:IG_like 263 340 2e-38 BLAST
IG 434 515 7.36e-2 SMART
IGc2 530 595 1.91e-9 SMART
IGc2 621 685 4.81e-15 SMART
IGc2 711 773 1.09e-13 SMART
IGc2 799 866 2.72e-14 SMART
IGc2 894 959 1.95e-15 SMART
IGc2 985 1049 5e-13 SMART
IGc2 1082 1147 1.09e-13 SMART
low complexity region 1151 1169 N/A INTRINSIC
IGc2 1173 1232 7.07e-13 SMART
IGc2 1260 1326 4.31e-17 SMART
IGc2 1354 1428 3e-16 SMART
IGc2 1456 1522 1.82e-15 SMART
IGc2 1550 1615 2.7e-18 SMART
IGc2 1644 1708 1.3e-11 SMART
IGc2 1736 1801 6.69e-14 SMART
IG 1826 1917 2.31e0 SMART
IGc2 1932 1997 4.62e-17 SMART
IGc2 2024 2091 3.25e-12 SMART
IGc2 2117 2182 1.28e-10 SMART
IGc2 2209 2276 3.76e-8 SMART
IGc2 2305 2370 2.6e-11 SMART
IGc2 2399 2464 1.32e-12 SMART
IGc2 2492 2557 2.06e-14 SMART
IGc2 2588 2653 3.9e-15 SMART
IGc2 2686 2751 2.64e-12 SMART
IGc2 2797 2862 9.05e-11 SMART
IGc2 2892 2957 4.7e-9 SMART
IGc2 2984 3049 1.44e-13 SMART
IGc2 3079 3144 9.33e-13 SMART
IGc2 3171 3236 3.79e-13 SMART
IGc2 3264 3331 1.85e-16 SMART
IGc2 3360 3425 9.61e-15 SMART
low complexity region 3433 3445 N/A INTRINSIC
IGc2 3453 3514 5.83e-14 SMART
IGc2 3542 3600 1.76e-8 SMART
low complexity region 3613 3627 N/A INTRINSIC
IGc2 3628 3693 5.2e-11 SMART
IGc2 3719 3784 2.64e-12 SMART
IGc2 3810 3877 3.35e-5 SMART
IGc2 3903 3968 3.73e-12 SMART
IGc2 3994 4058 4.39e-9 SMART
IGc2 4084 4149 1.79e-14 SMART
low complexity region 4157 4169 N/A INTRINSIC
IGc2 4175 4238 9.33e-13 SMART
IGc2 4265 4329 7.22e-19 SMART
IGc2 4355 4419 1.59e-15 SMART
Pfam:G2F 4431 4613 1.7e-56 PFAM
EGF_CA 4668 4708 5.78e-11 SMART
EGF_CA 4709 4753 9.39e-11 SMART
EGF_CA 4754 4796 7.69e-7 SMART
EGF_CA 4797 4837 2.19e-11 SMART
EGF_CA 4904 4943 6.74e-12 SMART
EGF_like 4944 4989 1.87e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226996
AA Change: S1352L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.1220 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (105/108)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abca8b G T 11: 109,957,075 T798K possibly damaging Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adsl G T 15: 80,962,742 E70* probably null Het
Ahcyl2 A G 6: 29,768,584 probably benign Het
AI314180 A G 4: 58,805,539 probably null Het
Akr1a1 A G 4: 116,636,653 V310A probably benign Het
Alpk3 T A 7: 81,076,931 C121* probably null Het
Amph T A 13: 18,948,455 I8N probably damaging Het
Ano2 G A 6: 125,863,457 A364T probably damaging Het
Apbb2 T C 5: 66,400,177 T314A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip A G 6: 136,587,260 T834A probably benign Het
Brca2 T G 5: 150,540,198 D1142E probably benign Het
Cap2 A G 13: 46,615,347 S210G probably benign Het
Capn2 C A 1: 182,472,960 E596D possibly damaging Het
Cdc27 A T 11: 104,522,822 S358R probably benign Het
Cdhr3 C T 12: 33,045,205 G622S probably null Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Crhr1 A T 11: 104,133,072 M1L probably benign Het
Csmd1 T C 8: 16,223,326 T831A probably damaging Het
Cwc22 T C 2: 77,924,659 probably benign Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Cyp4a31 T C 4: 115,566,613 probably null Het
Cytip A C 2: 58,134,146 S221A probably benign Het
Dagla G A 19: 10,263,186 R227C possibly damaging Het
Dhx57 A G 17: 80,253,085 probably null Het
Dnah2 A T 11: 69,514,804 D627E probably damaging Het
Dock8 A G 19: 25,161,058 E1249G probably benign Het
Dpysl3 A G 18: 43,342,328 V31A probably benign Het
Fan1 T C 7: 64,372,806 N233S probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Glipr1 T A 10: 111,996,860 M58L possibly damaging Het
Gm10509 C T 17: 21,690,858 P31S possibly damaging Het
Gm5070 T C 3: 95,411,044 noncoding transcript Het
Gramd1a T C 7: 31,142,573 N138S probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
Hoxa5 G A 6: 52,202,732 T221I probably damaging Het
Hsd17b2 C A 8: 117,758,749 P317Q possibly damaging Het
Ifi213 T A 1: 173,589,842 S335C probably damaging Het
Izumo4 A T 10: 80,703,895 D156V probably damaging Het
Khnyn A T 14: 55,885,852 E21V probably damaging Het
Kmt2d C T 15: 98,861,780 G1199E unknown Het
Lipk T C 19: 34,039,091 W240R probably benign Het
Lpar5 A G 6: 125,081,415 D33G possibly damaging Het
Lrp11 A G 10: 7,596,197 D219G probably damaging Het
Lrrcc1 T C 3: 14,559,225 probably benign Het
Man2a1 T C 17: 64,740,842 C252R probably damaging Het
Map2k5 A G 9: 63,235,303 F354L possibly damaging Het
Mlh3 T C 12: 85,266,145 probably benign Het
Mmp28 A G 11: 83,444,219 I331T probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Nckap1 A G 2: 80,517,898 S898P possibly damaging Het
Nectin1 T A 9: 43,791,077 Y40* probably null Het
Neurl1a T A 19: 47,257,459 V493E probably benign Het
Ntf3 A C 6: 126,102,246 I99S probably benign Het
Olfr1115 T C 2: 87,252,710 S258P possibly damaging Het
Olfr1386 T A 11: 49,470,968 F272L probably benign Het
Olfr318 A T 11: 58,720,307 V247E probably damaging Het
Olfr365 C G 2: 37,201,980 H246Q probably damaging Het
Olfr406 A G 11: 74,270,240 T284A probably benign Het
Olfr421-ps1 C T 1: 174,152,214 R233C probably benign Het
Olfr94 A G 17: 37,196,831 probably benign Het
Otof G A 5: 30,378,710 T1343I probably benign Het
Otop2 A T 11: 115,324,628 Y125F probably benign Het
Pate3 G A 9: 35,646,105 T85I probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Phf11d T C 14: 59,356,329 H132R probably benign Het
Pik3c3 G A 18: 30,344,077 probably null Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prkdc G A 16: 15,759,605 D2372N probably damaging Het
Ptprq C T 10: 107,718,478 E129K probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Ralgapb T A 2: 158,492,452 V1027E probably damaging Het
Rita1 T C 5: 120,609,580 T218A possibly damaging Het
Rrh T A 3: 129,812,633 T218S probably damaging Het
Scaper C T 9: 55,859,900 A416T probably damaging Het
Scn3a A G 2: 65,484,372 L1115P probably damaging Het
Serpinb6e A T 13: 33,833,234 S268T probably damaging Het
Slc1a6 G A 10: 78,812,931 W495* probably null Het
Slc32a1 A G 2: 158,611,378 H46R probably benign Het
Slc37a1 C T 17: 31,300,431 probably benign Het
Slc6a5 T A 7: 49,956,425 W694R probably benign Het
Smarcd2 A T 11: 106,267,396 D113E probably benign Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Sspo A T 6: 48,492,886 Q4506L possibly damaging Het
Stam2 T A 2: 52,716,527 E115D probably damaging Het
Sult1c1 A T 17: 53,973,925 L50H probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Togaram1 T G 12: 64,995,635 V1156G probably damaging Het
Tpp1 T C 7: 105,749,647 T192A probably benign Het
Ttc37 C A 13: 76,130,288 H574N probably benign Het
Ush1c A G 7: 46,209,901 L498P probably damaging Het
Vit A C 17: 78,622,836 Q410P probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Zfp341 A G 2: 154,646,134 E839G possibly damaging Het
Zhx3 G A 2: 160,780,355 L631F probably benign Het
Zmpste24 T C 4: 121,087,316 E95G possibly damaging Het
Other mutations in Hmcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Hmcn2 APN 2 31343096 missense probably damaging 1.00
IGL00966:Hmcn2 APN 2 31428994 missense probably damaging 0.97
IGL00973:Hmcn2 APN 2 31383821 intron probably benign
IGL01364:Hmcn2 APN 2 31361814 nonsense probably null
IGL01486:Hmcn2 APN 2 31336621 missense probably damaging 1.00
IGL01530:Hmcn2 APN 2 31354264 missense possibly damaging 0.85
IGL01550:Hmcn2 APN 2 31424252 missense possibly damaging 0.84
IGL01710:Hmcn2 APN 2 31343102 missense probably damaging 1.00
IGL01764:Hmcn2 APN 2 31405630 missense possibly damaging 0.93
IGL01924:Hmcn2 APN 2 31398917 missense probably benign 0.00
IGL02003:Hmcn2 APN 2 31428982 missense possibly damaging 0.90
IGL02117:Hmcn2 APN 2 31457173 missense possibly damaging 0.75
IGL02205:Hmcn2 APN 2 31400127 missense probably damaging 1.00
IGL02273:Hmcn2 APN 2 31424377 missense probably benign 0.06
IGL02313:Hmcn2 APN 2 31453605 missense possibly damaging 0.68
IGL02326:Hmcn2 APN 2 31450952 missense probably damaging 0.97
IGL02486:Hmcn2 APN 2 31420095 missense probably damaging 0.98
IGL02551:Hmcn2 APN 2 31454811 missense possibly damaging 0.83
IGL02695:Hmcn2 APN 2 31408973 missense possibly damaging 0.87
IGL02725:Hmcn2 APN 2 31405528 missense probably damaging 1.00
IGL02792:Hmcn2 APN 2 31346590 missense probably damaging 1.00
IGL02882:Hmcn2 APN 2 31413367 nonsense probably null
IGL03003:Hmcn2 APN 2 31433486 missense probably damaging 0.98
IGL03067:Hmcn2 APN 2 31346630 missense probably damaging 1.00
IGL03137:Hmcn2 APN 2 31362230 missense probably damaging 0.98
IGL03220:Hmcn2 APN 2 31346621 missense possibly damaging 0.94
IGL03411:Hmcn2 APN 2 31346637 missense possibly damaging 0.83
PIT4544001:Hmcn2 UTSW 2 31428250 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0078:Hmcn2 UTSW 2 31388344 missense probably damaging 1.00
R0090:Hmcn2 UTSW 2 31426198 missense probably damaging 1.00
R0173:Hmcn2 UTSW 2 31438331 critical splice donor site probably null
R0257:Hmcn2 UTSW 2 31369164 splice site probably benign
R0266:Hmcn2 UTSW 2 31394827 missense probably benign 0.03
R0266:Hmcn2 UTSW 2 31445353 splice site probably benign
R0326:Hmcn2 UTSW 2 31423225 nonsense probably null
R0366:Hmcn2 UTSW 2 31424206 missense possibly damaging 0.88
R0400:Hmcn2 UTSW 2 31400129 missense probably damaging 0.98
R0412:Hmcn2 UTSW 2 31388247 missense probably damaging 0.98
R0436:Hmcn2 UTSW 2 31405612 missense probably damaging 1.00
R0457:Hmcn2 UTSW 2 31415284 critical splice donor site probably null
R0487:Hmcn2 UTSW 2 31386677 missense possibly damaging 0.60
R0568:Hmcn2 UTSW 2 31415236 missense probably benign 0.02
R0755:Hmcn2 UTSW 2 31453160 missense probably damaging 0.99
R0811:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0812:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0964:Hmcn2 UTSW 2 31391511 missense probably benign 0.23
R0988:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R1484:Hmcn2 UTSW 2 31346495 missense probably damaging 1.00
R1509:Hmcn2 UTSW 2 31314479 missense possibly damaging 0.86
R1535:Hmcn2 UTSW 2 31420407 missense possibly damaging 0.91
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1600:Hmcn2 UTSW 2 31430787 missense probably damaging 0.98
R1623:Hmcn2 UTSW 2 31458039 missense possibly damaging 0.84
R1692:Hmcn2 UTSW 2 31450844 missense possibly damaging 0.47
R1719:Hmcn2 UTSW 2 31354721 missense probably damaging 1.00
R1747:Hmcn2 UTSW 2 31457985 missense probably benign 0.00
R1756:Hmcn2 UTSW 2 31396120 missense probably damaging 0.99
R1763:Hmcn2 UTSW 2 31314590 missense probably damaging 1.00
R1815:Hmcn2 UTSW 2 31393043 missense probably damaging 0.97
R1858:Hmcn2 UTSW 2 31415283 critical splice donor site probably null
R1895:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1908:Hmcn2 UTSW 2 31411910 critical splice donor site probably null
R1946:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1966:Hmcn2 UTSW 2 31389329 missense probably damaging 0.99
R2007:Hmcn2 UTSW 2 31438255 missense possibly damaging 0.91
R2050:Hmcn2 UTSW 2 31335436 missense probably damaging 1.00
R2055:Hmcn2 UTSW 2 31378282 missense probably benign 0.33
R2097:Hmcn2 UTSW 2 31380419 missense probably damaging 1.00
R2145:Hmcn2 UTSW 2 31333931 splice site probably benign
R2155:Hmcn2 UTSW 2 31460349 missense possibly damaging 0.68
R2170:Hmcn2 UTSW 2 31380281 missense probably benign 0.08
R2188:Hmcn2 UTSW 2 31419935 missense probably benign 0.14
R2208:Hmcn2 UTSW 2 31380297 missense probably damaging 1.00
R2217:Hmcn2 UTSW 2 31350574 missense probably benign 0.02
R2407:Hmcn2 UTSW 2 31335412 critical splice acceptor site probably null
R2764:Hmcn2 UTSW 2 31388298 missense probably damaging 0.98
R2913:Hmcn2 UTSW 2 31460210 missense possibly damaging 0.68
R2986:Hmcn2 UTSW 2 31360998 missense probably damaging 1.00
R3157:Hmcn2 UTSW 2 31400255 missense probably damaging 0.99
R3406:Hmcn2 UTSW 2 31433272 splice site probably benign
R3429:Hmcn2 UTSW 2 31409144 missense possibly damaging 0.87
R3737:Hmcn2 UTSW 2 31336612 nonsense probably null
R3739:Hmcn2 UTSW 2 31336612 nonsense probably null
R3771:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3772:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3773:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3804:Hmcn2 UTSW 2 31352885 splice site probably null
R3837:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3838:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3846:Hmcn2 UTSW 2 31430350 missense possibly damaging 0.51
R3925:Hmcn2 UTSW 2 31453157 missense probably benign 0.00
R3934:Hmcn2 UTSW 2 31380484 critical splice donor site probably null
R3946:Hmcn2 UTSW 2 31382394 missense possibly damaging 0.91
R4035:Hmcn2 UTSW 2 31336612 nonsense probably null
R4057:Hmcn2 UTSW 2 31400238 missense probably damaging 1.00
R4583:Hmcn2 UTSW 2 31413265 missense possibly damaging 0.84
R4623:Hmcn2 UTSW 2 31396710 missense probably damaging 1.00
R4647:Hmcn2 UTSW 2 31399019 missense possibly damaging 0.82
R4668:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4669:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4687:Hmcn2 UTSW 2 31438285 missense probably benign 0.14
R4735:Hmcn2 UTSW 2 31383775 missense probably benign 0.06
R4772:Hmcn2 UTSW 2 31445314 missense probably benign 0.02
R4866:Hmcn2 UTSW 2 31389391 missense possibly damaging 0.88
R4916:Hmcn2 UTSW 2 31360980 missense probably damaging 0.98
R4943:Hmcn2 UTSW 2 31335492 missense probably damaging 1.00
R4967:Hmcn2 UTSW 2 31354164 critical splice acceptor site probably null
R4973:Hmcn2 UTSW 2 31344096 missense probably benign 0.15
R4975:Hmcn2 UTSW 2 31393025 missense possibly damaging 0.88
R4994:Hmcn2 UTSW 2 31458055 critical splice donor site probably null
R4997:Hmcn2 UTSW 2 31401708 missense probably damaging 1.00
R5045:Hmcn2 UTSW 2 31409081 missense probably damaging 1.00
R5117:Hmcn2 UTSW 2 31458049 missense possibly damaging 0.95
R5151:Hmcn2 UTSW 2 31389443 missense probably null
R5232:Hmcn2 UTSW 2 31457748 missense probably damaging 0.99
R5237:Hmcn2 UTSW 2 31414716 missense probably benign 0.01
R5288:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5375:Hmcn2 UTSW 2 31430441 missense possibly damaging 0.92
R5379:Hmcn2 UTSW 2 31409011 missense probably damaging 0.99
R5385:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5412:Hmcn2 UTSW 2 31346617 missense possibly damaging 0.77
R5426:Hmcn2 UTSW 2 31336544 missense possibly damaging 0.95
R5434:Hmcn2 UTSW 2 31420363 missense probably damaging 1.00
R5441:Hmcn2 UTSW 2 31406416 missense possibly damaging 0.82
R5484:Hmcn2 UTSW 2 31393054 nonsense probably null
R5492:Hmcn2 UTSW 2 31420306 missense probably benign 0.03
R5572:Hmcn2 UTSW 2 31414525 critical splice acceptor site probably null
R5572:Hmcn2 UTSW 2 31414526 critical splice acceptor site probably null
R5591:Hmcn2 UTSW 2 31344047 missense probably damaging 1.00
R5614:Hmcn2 UTSW 2 31428303 missense probably damaging 0.99
R5634:Hmcn2 UTSW 2 31333881 missense probably damaging 1.00
R5645:Hmcn2 UTSW 2 31420812 missense possibly damaging 0.92
R5716:Hmcn2 UTSW 2 31336567 missense probably damaging 1.00
R5716:Hmcn2 UTSW 2 31458738 missense possibly damaging 0.68
R5725:Hmcn2 UTSW 2 31383815 critical splice donor site probably null
R5760:Hmcn2 UTSW 2 31414568 missense possibly damaging 0.91
R5774:Hmcn2 UTSW 2 31409135 missense possibly damaging 0.94
R5838:Hmcn2 UTSW 2 31457807 missense probably damaging 0.99
R5899:Hmcn2 UTSW 2 31354673 missense possibly damaging 0.93
R5916:Hmcn2 UTSW 2 31396139 missense probably damaging 1.00
R5973:Hmcn2 UTSW 2 31420323 missense probably damaging 0.99
R6002:Hmcn2 UTSW 2 31420309 missense probably damaging 0.99
R6018:Hmcn2 UTSW 2 31370792 missense probably benign 0.13
R6063:Hmcn2 UTSW 2 31434713 missense probably benign 0.06
R6161:Hmcn2 UTSW 2 31356254 missense probably benign
R6166:Hmcn2 UTSW 2 31369262 missense probably damaging 1.00
R6177:Hmcn2 UTSW 2 31420106 nonsense probably null
R6191:Hmcn2 UTSW 2 31458746 missense probably damaging 0.99
R6195:Hmcn2 UTSW 2 31384115 missense probably damaging 0.96
R6273:Hmcn2 UTSW 2 31411834 missense probably damaging 0.99
R6293:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R6349:Hmcn2 UTSW 2 31388373 missense probably damaging 1.00
R6395:Hmcn2 UTSW 2 31369257 missense probably damaging 1.00
R6448:Hmcn2 UTSW 2 31420820 missense probably benign 0.02
R6450:Hmcn2 UTSW 2 31361800 missense probably benign 0.11
R6479:Hmcn2 UTSW 2 31425468 missense probably damaging 0.99
R6502:Hmcn2 UTSW 2 31382478 missense probably damaging 0.99
R6511:Hmcn2 UTSW 2 31356342 missense possibly damaging 0.79
R6537:Hmcn2 UTSW 2 31415268 missense probably benign 0.00
R6880:Hmcn2 UTSW 2 31343056 missense probably damaging 1.00
R6924:Hmcn2 UTSW 2 31350505 splice site probably null
R6971:Hmcn2 UTSW 2 31432321 missense probably benign 0.02
R7057:Hmcn2 UTSW 2 31422649 missense probably damaging 0.99
R7141:Hmcn2 UTSW 2 31360896 missense probably benign 0.17
R7268:Hmcn2 UTSW 2 31457966 missense possibly damaging 0.48
R7307:Hmcn2 UTSW 2 31343081 missense probably damaging 0.96
R7322:Hmcn2 UTSW 2 31459081 missense probably damaging 0.99
R7334:Hmcn2 UTSW 2 31435794 missense probably damaging 0.98
R7334:Hmcn2 UTSW 2 31453135 missense possibly damaging 0.82
R7335:Hmcn2 UTSW 2 31392157 missense possibly damaging 0.88
R7358:Hmcn2 UTSW 2 31416812 missense probably damaging 1.00
R7359:Hmcn2 UTSW 2 31388383 missense probably benign 0.13
R7488:Hmcn2 UTSW 2 31420830 missense probably damaging 1.00
R7498:Hmcn2 UTSW 2 31383475 splice site probably null
R7560:Hmcn2 UTSW 2 31457173 missense probably benign
R7566:Hmcn2 UTSW 2 31454857 missense probably damaging 0.96
R7570:Hmcn2 UTSW 2 31423911 missense probably benign
R7574:Hmcn2 UTSW 2 31455519 missense possibly damaging 0.68
R7599:Hmcn2 UTSW 2 31356286 missense possibly damaging 0.93
R7654:Hmcn2 UTSW 2 31346569 missense probably benign 0.00
R7662:Hmcn2 UTSW 2 31382345 missense probably benign 0.01
R7666:Hmcn2 UTSW 2 31380233 missense probably damaging 1.00
R7698:Hmcn2 UTSW 2 31423153 missense probably damaging 0.98
R7722:Hmcn2 UTSW 2 31382500 nonsense probably null
R7739:Hmcn2 UTSW 2 31458026 missense possibly damaging 0.48
R7749:Hmcn2 UTSW 2 31453033 splice site probably null
R7828:Hmcn2 UTSW 2 31405875 missense possibly damaging 0.95
R7912:Hmcn2 UTSW 2 31420299 missense probably benign 0.00
R7978:Hmcn2 UTSW 2 31389347 missense probably benign 0.40
R8075:Hmcn2 UTSW 2 31389391 missense possibly damaging 0.88
R8088:Hmcn2 UTSW 2 31426903 nonsense probably null
R8101:Hmcn2 UTSW 2 31350070 missense probably benign 0.08
R8124:Hmcn2 UTSW 2 31400124 missense probably benign 0.01
R8145:Hmcn2 UTSW 2 31423105 missense probably damaging 1.00
R8230:Hmcn2 UTSW 2 31344473 missense possibly damaging 0.91
R8267:Hmcn2 UTSW 2 31459179 missense probably benign
R8277:Hmcn2 UTSW 2 31369177 missense probably benign 0.16
R8307:Hmcn2 UTSW 2 31396115 missense probably damaging 0.99
R8415:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8416:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8437:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8438:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8442:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
X0066:Hmcn2 UTSW 2 31454811 missense possibly damaging 0.83
X0067:Hmcn2 UTSW 2 31405867 missense possibly damaging 0.82
Z1088:Hmcn2 UTSW 2 31459064 splice site probably null
Z1088:Hmcn2 UTSW 2 31381067 missense probably benign 0.01
Z1176:Hmcn2 UTSW 2 31344029 missense possibly damaging 0.95
Z1176:Hmcn2 UTSW 2 31425416 missense probably damaging 1.00
Z1176:Hmcn2 UTSW 2 31429091 missense probably damaging 0.97
Z1177:Hmcn2 UTSW 2 31344506 missense probably damaging 1.00
Z1177:Hmcn2 UTSW 2 31426824 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCTTGTGGTTAGATCAGG -3'
(R):5'- AAGGACATTTGTCACATTCCCATG -3'

Sequencing Primer
(F):5'- CCCTTGTGGTTAGATCAGGATAGATG -3'
(R):5'- CATGTCCCTTAGCACACAGAG -3'
Posted On2014-06-23