Incidental Mutation 'R1822:Scn3a'
ID206439
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
MMRRC Submission 039850-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1822 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65484372 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1115 (L1115P)
Ref Sequence ENSEMBL: ENSMUSP00000097647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect probably damaging
Transcript: ENSMUST00000066432
AA Change: L1115P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: L1115P

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100069
AA Change: L1115P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: L1115P

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (105/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abca8b G T 11: 109,957,075 T798K possibly damaging Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adsl G T 15: 80,962,742 E70* probably null Het
Ahcyl2 A G 6: 29,768,584 probably benign Het
AI314180 A G 4: 58,805,539 probably null Het
Akr1a1 A G 4: 116,636,653 V310A probably benign Het
Alpk3 T A 7: 81,076,931 C121* probably null Het
Amph T A 13: 18,948,455 I8N probably damaging Het
Ano2 G A 6: 125,863,457 A364T probably damaging Het
Apbb2 T C 5: 66,400,177 T314A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip A G 6: 136,587,260 T834A probably benign Het
Brca2 T G 5: 150,540,198 D1142E probably benign Het
Cap2 A G 13: 46,615,347 S210G probably benign Het
Capn2 C A 1: 182,472,960 E596D possibly damaging Het
Cdc27 A T 11: 104,522,822 S358R probably benign Het
Cdhr3 C T 12: 33,045,205 G622S probably null Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Crhr1 A T 11: 104,133,072 M1L probably benign Het
Csmd1 T C 8: 16,223,326 T831A probably damaging Het
Cwc22 T C 2: 77,924,659 probably benign Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Cyp4a31 T C 4: 115,566,613 probably null Het
Cytip A C 2: 58,134,146 S221A probably benign Het
Dagla G A 19: 10,263,186 R227C possibly damaging Het
Dhx57 A G 17: 80,253,085 probably null Het
Dnah2 A T 11: 69,514,804 D627E probably damaging Het
Dock8 A G 19: 25,161,058 E1249G probably benign Het
Dpysl3 A G 18: 43,342,328 V31A probably benign Het
Fan1 T C 7: 64,372,806 N233S probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Glipr1 T A 10: 111,996,860 M58L possibly damaging Het
Gm10509 C T 17: 21,690,858 P31S possibly damaging Het
Gm5070 T C 3: 95,411,044 noncoding transcript Het
Gramd1a T C 7: 31,142,573 N138S probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
Hmcn2 C T 2: 31,383,692 S1352L probably damaging Het
Hoxa5 G A 6: 52,202,732 T221I probably damaging Het
Hsd17b2 C A 8: 117,758,749 P317Q possibly damaging Het
Ifi213 T A 1: 173,589,842 S335C probably damaging Het
Izumo4 A T 10: 80,703,895 D156V probably damaging Het
Khnyn A T 14: 55,885,852 E21V probably damaging Het
Kmt2d C T 15: 98,861,780 G1199E unknown Het
Lipk T C 19: 34,039,091 W240R probably benign Het
Lpar5 A G 6: 125,081,415 D33G possibly damaging Het
Lrp11 A G 10: 7,596,197 D219G probably damaging Het
Lrrcc1 T C 3: 14,559,225 probably benign Het
Man2a1 T C 17: 64,740,842 C252R probably damaging Het
Map2k5 A G 9: 63,235,303 F354L possibly damaging Het
Mlh3 T C 12: 85,266,145 probably benign Het
Mmp28 A G 11: 83,444,219 I331T probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Nckap1 A G 2: 80,517,898 S898P possibly damaging Het
Nectin1 T A 9: 43,791,077 Y40* probably null Het
Neurl1a T A 19: 47,257,459 V493E probably benign Het
Ntf3 A C 6: 126,102,246 I99S probably benign Het
Olfr1115 T C 2: 87,252,710 S258P possibly damaging Het
Olfr1386 T A 11: 49,470,968 F272L probably benign Het
Olfr318 A T 11: 58,720,307 V247E probably damaging Het
Olfr365 C G 2: 37,201,980 H246Q probably damaging Het
Olfr406 A G 11: 74,270,240 T284A probably benign Het
Olfr421-ps1 C T 1: 174,152,214 R233C probably benign Het
Olfr94 A G 17: 37,196,831 probably benign Het
Otof G A 5: 30,378,710 T1343I probably benign Het
Otop2 A T 11: 115,324,628 Y125F probably benign Het
Pate3 G A 9: 35,646,105 T85I probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Phf11d T C 14: 59,356,329 H132R probably benign Het
Pik3c3 G A 18: 30,344,077 probably null Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prkdc G A 16: 15,759,605 D2372N probably damaging Het
Ptprq C T 10: 107,718,478 E129K probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Ralgapb T A 2: 158,492,452 V1027E probably damaging Het
Rita1 T C 5: 120,609,580 T218A possibly damaging Het
Rrh T A 3: 129,812,633 T218S probably damaging Het
Scaper C T 9: 55,859,900 A416T probably damaging Het
Serpinb6e A T 13: 33,833,234 S268T probably damaging Het
Slc1a6 G A 10: 78,812,931 W495* probably null Het
Slc32a1 A G 2: 158,611,378 H46R probably benign Het
Slc37a1 C T 17: 31,300,431 probably benign Het
Slc6a5 T A 7: 49,956,425 W694R probably benign Het
Smarcd2 A T 11: 106,267,396 D113E probably benign Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Sspo A T 6: 48,492,886 Q4506L possibly damaging Het
Stam2 T A 2: 52,716,527 E115D probably damaging Het
Sult1c1 A T 17: 53,973,925 L50H probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Togaram1 T G 12: 64,995,635 V1156G probably damaging Het
Tpp1 T C 7: 105,749,647 T192A probably benign Het
Ttc37 C A 13: 76,130,288 H574N probably benign Het
Ush1c A G 7: 46,209,901 L498P probably damaging Het
Vit A C 17: 78,622,836 Q410P probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Zfp341 A G 2: 154,646,134 E839G possibly damaging Het
Zhx3 G A 2: 160,780,355 L631F probably benign Het
Zmpste24 T C 4: 121,087,316 E95G possibly damaging Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4918:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5730:Scn3a UTSW 2 65495260 missense probably benign 0.00
R5735:Scn3a UTSW 2 65484459 missense probably benign 0.09
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5935:Scn3a UTSW 2 65464836 missense probably damaging 1.00
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6235:Scn3a UTSW 2 65461335 missense probably damaging 0.97
R6307:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6376:Scn3a UTSW 2 65461499 missense possibly damaging 0.88
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7352:Scn3a UTSW 2 65525701 missense possibly damaging 0.51
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7733:Scn3a UTSW 2 65508650 missense probably benign 0.08
R7761:Scn3a UTSW 2 65529454 missense possibly damaging 0.95
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7967:Scn3a UTSW 2 65536515 missense probably damaging 0.96
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCATTGGTCCAGACACAGG -3'
(R):5'- CCACACATATGACAGAGTGTTTCCTG -3'

Sequencing Primer
(F):5'- GACACAGGCTCGTCTGTAGTCTAATC -3'
(R):5'- TGACAGAGTGTTTCCTGATCAC -3'
Posted On2014-06-23