Mutagenetix > Incidental Mutation

Incidental Mutation 'R1822:Dnah2'

206495

Institutional Source

Beutler Lab

Gene Symbol

Dnah2

Ensembl Gene

ENSMUSG00000005237

Gene Name

dynein, axonemal, heavy chain 2

Synonyms

Dnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik

MMRRC Submission

039850-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1822 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69420809-69549110 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69514804 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 627 (D627E)

Ref Sequence

ENSEMBL: ENSMUSP00000104299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659] [ENSMUST00000208777]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035539
AA Change: D627E

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: D627E

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
Pfam:DHC_N1	273	429	6.6e-37	PFAM
Pfam:DHC_N1	432	761	1.3e-54	PFAM
Pfam:DHC_N2	1253	1668	3.4e-144	PFAM
AAA	1826	1962	2.95e-1	SMART
Pfam:AAA_5	2108	2251	1.3e-5	PFAM
AAA	2437	2584	3.63e-5	SMART
Pfam:AAA_8	2752	3022	1.1e-75	PFAM
Pfam:MT	3034	3370	8.7e-55	PFAM
Pfam:AAA_9	3386	3616	7.4e-68	PFAM
Pfam:Dynein_heavy	3748	4453	1.2e-220	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108659
AA Change: D627E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: D627E

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
Pfam:DHC_N1	274	429	1.1e-47	PFAM
Pfam:DHC_N1	438	760	1.5e-75	PFAM
Pfam:DHC_N2	1255	1666	4.4e-144	PFAM
low complexity region	1711	1720	N/A	INTRINSIC
AAA	1832	1968	2.95e-1	SMART
Blast:AAA	2111	2251	2e-86	BLAST
AAA	2443	2590	3.63e-5	SMART
Pfam:AAA_8	2758	3028	5.5e-77	PFAM
Pfam:MT	3040	3376	7.6e-55	PFAM
Pfam:AAA_9	3396	3621	7.5e-94	PFAM
Pfam:Dynein_heavy	3759	4458	4.9e-264	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149991

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154985

Predicted Effect

probably benign
Transcript: ENSMUST00000208777

Meta Mutation Damage Score

0.6421

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.7%

Validation Efficiency

97% (105/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	T	C	19: 29,716,414	N1960S	probably damaging	Het
Abca8b	G	T	11: 109,957,075	T798K	possibly damaging	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Adsl	G	T	15: 80,962,742	E70*	probably null	Het
Ahcyl2	A	G	6: 29,768,584		probably benign	Het
AI314180	A	G	4: 58,805,539		probably null	Het
Akr1a1	A	G	4: 116,636,653	V310A	probably benign	Het
Alpk3	T	A	7: 81,076,931	C121*	probably null	Het
Amph	T	A	13: 18,948,455	I8N	probably damaging	Het
Ano2	G	A	6: 125,863,457	A364T	probably damaging	Het
Apbb2	T	C	5: 66,400,177	T314A	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atf7ip	A	G	6: 136,587,260	T834A	probably benign	Het
Brca2	T	G	5: 150,540,198	D1142E	probably benign	Het
Cap2	A	G	13: 46,615,347	S210G	probably benign	Het
Capn2	C	A	1: 182,472,960	E596D	possibly damaging	Het
Cdc27	A	T	11: 104,522,822	S358R	probably benign	Het
Cdhr3	C	T	12: 33,045,205	G622S	probably null	Het
Clip2	A	G	5: 134,503,227	Y540H	probably benign	Het
Crhr1	A	T	11: 104,133,072	M1L	probably benign	Het
Csmd1	T	C	8: 16,223,326	T831A	probably damaging	Het
Cwc22	T	C	2: 77,924,659		probably benign	Het
Cyp3a25	T	A	5: 145,984,953	K390N	probably damaging	Het
Cyp4a31	T	C	4: 115,566,613		probably null	Het
Cytip	A	C	2: 58,134,146	S221A	probably benign	Het
Dagla	G	A	19: 10,263,186	R227C	possibly damaging	Het
Dhx57	A	G	17: 80,253,085		probably null	Het
Dock8	A	G	19: 25,161,058	E1249G	probably benign	Het
Dpysl3	A	G	18: 43,342,328	V31A	probably benign	Het
Fan1	T	C	7: 64,372,806	N233S	probably benign	Het
Fras1	A	T	5: 96,770,688	I3528F	probably damaging	Het
Glipr1	T	A	10: 111,996,860	M58L	possibly damaging	Het
Gm10509	C	T	17: 21,690,858	P31S	possibly damaging	Het
Gm5070	T	C	3: 95,411,044		noncoding transcript	Het
Gramd1a	T	C	7: 31,142,573	N138S	probably damaging	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
Hmcn2	C	T	2: 31,383,692	S1352L	probably damaging	Het
Hoxa5	G	A	6: 52,202,732	T221I	probably damaging	Het
Hsd17b2	C	A	8: 117,758,749	P317Q	possibly damaging	Het
Ifi213	T	A	1: 173,589,842	S335C	probably damaging	Het
Izumo4	A	T	10: 80,703,895	D156V	probably damaging	Het
Khnyn	A	T	14: 55,885,852	E21V	probably damaging	Het
Kmt2d	C	T	15: 98,861,780	G1199E	unknown	Het
Lipk	T	C	19: 34,039,091	W240R	probably benign	Het
Lpar5	A	G	6: 125,081,415	D33G	possibly damaging	Het
Lrp11	A	G	10: 7,596,197	D219G	probably damaging	Het
Lrrcc1	T	C	3: 14,559,225		probably benign	Het
Man2a1	T	C	17: 64,740,842	C252R	probably damaging	Het
Map2k5	A	G	9: 63,235,303	F354L	possibly damaging	Het
Mlh3	T	C	12: 85,266,145		probably benign	Het
Mmp28	A	G	11: 83,444,219	I331T	probably damaging	Het
Muc4	G	C	16: 32,753,919	R1265P	probably benign	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Nckap1	A	G	2: 80,517,898	S898P	possibly damaging	Het
Nectin1	T	A	9: 43,791,077	Y40*	probably null	Het
Neurl1a	T	A	19: 47,257,459	V493E	probably benign	Het
Ntf3	A	C	6: 126,102,246	I99S	probably benign	Het
Olfr1115	T	C	2: 87,252,710	S258P	possibly damaging	Het
Olfr1386	T	A	11: 49,470,968	F272L	probably benign	Het
Olfr318	A	T	11: 58,720,307	V247E	probably damaging	Het
Olfr365	C	G	2: 37,201,980	H246Q	probably damaging	Het
Olfr406	A	G	11: 74,270,240	T284A	probably benign	Het
Olfr421-ps1	C	T	1: 174,152,214	R233C	probably benign	Het
Olfr94	A	G	17: 37,196,831		probably benign	Het
Otof	G	A	5: 30,378,710	T1343I	probably benign	Het
Otop2	A	T	11: 115,324,628	Y125F	probably benign	Het
Pate3	G	A	9: 35,646,105	T85I	probably benign	Het
Pdpk1	A	T	17: 24,098,176		probably benign	Het
Phf11d	T	C	14: 59,356,329	H132R	probably benign	Het
Pik3c3	G	A	18: 30,344,077		probably null	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Prkdc	G	A	16: 15,759,605	D2372N	probably damaging	Het
Ptprq	C	T	10: 107,718,478	E129K	probably damaging	Het
Pym1	G	A	10: 128,766,044		probably benign	Het
Ralgapb	T	A	2: 158,492,452	V1027E	probably damaging	Het
Rita1	T	C	5: 120,609,580	T218A	possibly damaging	Het
Rrh	T	A	3: 129,812,633	T218S	probably damaging	Het
Scaper	C	T	9: 55,859,900	A416T	probably damaging	Het
Scn3a	A	G	2: 65,484,372	L1115P	probably damaging	Het
Serpinb6e	A	T	13: 33,833,234	S268T	probably damaging	Het
Slc1a6	G	A	10: 78,812,931	W495*	probably null	Het
Slc32a1	A	G	2: 158,611,378	H46R	probably benign	Het
Slc37a1	C	T	17: 31,300,431		probably benign	Het
Slc6a5	T	A	7: 49,956,425	W694R	probably benign	Het
Smarcd2	A	T	11: 106,267,396	D113E	probably benign	Het
Sod3	G	T	5: 52,368,162	V68L	probably benign	Het
Srpk3	G	A	X: 73,777,955	R425Q	possibly damaging	Het
Sspo	A	T	6: 48,492,886	Q4506L	possibly damaging	Het
Stam2	T	A	2: 52,716,527	E115D	probably damaging	Het
Sult1c1	A	T	17: 53,973,925	L50H	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Togaram1	T	G	12: 64,995,635	V1156G	probably damaging	Het
Tpp1	T	C	7: 105,749,647	T192A	probably benign	Het
Ttc37	C	A	13: 76,130,288	H574N	probably benign	Het
Ush1c	A	G	7: 46,209,901	L498P	probably damaging	Het
Vit	A	C	17: 78,622,836	Q410P	probably benign	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Zfp341	A	G	2: 154,646,134	E839G	possibly damaging	Het
Zhx3	G	A	2: 160,780,355	L631F	probably benign	Het
Zmpste24	T	C	4: 121,087,316	E95G	possibly damaging	Het

Other mutations in Dnah2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Dnah2	APN	11	69492672	missense	possibly damaging	0.93
IGL00418:Dnah2	APN	11	69495066	splice site	probably benign
IGL00772:Dnah2	APN	11	69451257	missense	probably damaging	0.97
IGL00819:Dnah2	APN	11	69473350	critical splice donor site	probably null
IGL00827:Dnah2	APN	11	69448457	missense	probably damaging	1.00
IGL01060:Dnah2	APN	11	69478092	missense	possibly damaging	0.86
IGL01340:Dnah2	APN	11	69493184	missense	probably damaging	0.99
IGL01349:Dnah2	APN	11	69475606	missense	probably damaging	0.99
IGL01413:Dnah2	APN	11	69432964	missense	probably damaging	0.99
IGL01451:Dnah2	APN	11	69474191	splice site	probably benign
IGL01480:Dnah2	APN	11	69458371	missense	possibly damaging	0.91
IGL01537:Dnah2	APN	11	69516080	missense	probably benign	0.17
IGL01592:Dnah2	APN	11	69431087	missense	probably benign	0.14
IGL01612:Dnah2	APN	11	69465063	splice site	probably benign
IGL01667:Dnah2	APN	11	69544395	missense	probably benign
IGL01667:Dnah2	APN	11	69520941	missense	probably damaging	0.98
IGL01691:Dnah2	APN	11	69539443	missense	probably benign
IGL02019:Dnah2	APN	11	69474285	missense	probably damaging	1.00
IGL02039:Dnah2	APN	11	69499212	missense	probably damaging	1.00
IGL02076:Dnah2	APN	11	69422559	missense	probably damaging	0.99
IGL02085:Dnah2	APN	11	69458185	missense	probably benign	0.07
IGL02158:Dnah2	APN	11	69458123	missense	probably benign
IGL02381:Dnah2	APN	11	69446292	missense	probably benign	0.25
IGL02681:Dnah2	APN	11	69452933	missense	probably benign	0.40
IGL02957:Dnah2	APN	11	69448507	missense	possibly damaging	0.96
IGL02961:Dnah2	APN	11	69518414	missense	probably damaging	1.00
IGL02969:Dnah2	APN	11	69521187	missense	possibly damaging	0.80
IGL03117:Dnah2	APN	11	69436291	splice site	probably benign
IGL03120:Dnah2	APN	11	69421848	missense	probably damaging	1.00
IGL03183:Dnah2	APN	11	69458488	missense	possibly damaging	0.94
IGL03197:Dnah2	APN	11	69459263	missense	probably damaging	1.00
IGL03263:Dnah2	APN	11	69529381	critical splice donor site	probably null
IGL03333:Dnah2	APN	11	69495123	missense	probably damaging	1.00
IGL03338:Dnah2	APN	11	69496577	missense	probably benign	0.13
argyrios	UTSW	11	69516590	missense	possibly damaging	0.47
Aureus	UTSW	11	69429348	missense	probably damaging	1.00
platinum	UTSW	11	69458042	missense	probably damaging	0.96
R0334_dnah2_144	UTSW	11	69436836	missense	probably damaging	1.00
R2150_dnah2_212	UTSW	11	69515761	missense	probably benign	0.14
BB005:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
BB015:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
E0370:Dnah2	UTSW	11	69515615	splice site	probably null
P0026:Dnah2	UTSW	11	69464947	missense	probably damaging	1.00
R0133:Dnah2	UTSW	11	69421009	missense	probably damaging	1.00
R0190:Dnah2	UTSW	11	69435249	missense	probably damaging	1.00
R0334:Dnah2	UTSW	11	69436836	missense	probably damaging	1.00
R0359:Dnah2	UTSW	11	69529531	missense	probably benign	0.00
R0386:Dnah2	UTSW	11	69447861	missense	probably damaging	1.00
R0414:Dnah2	UTSW	11	69499238	missense	probably benign	0.26
R0427:Dnah2	UTSW	11	69452879	missense	probably damaging	0.99
R0433:Dnah2	UTSW	11	69459288	missense	probably damaging	1.00
R0442:Dnah2	UTSW	11	69448542	missense	probably damaging	1.00
R0462:Dnah2	UTSW	11	69459201	missense	probably damaging	1.00
R0463:Dnah2	UTSW	11	69423126	missense	probably damaging	1.00
R0611:Dnah2	UTSW	11	69499194	missense	probably damaging	1.00
R0626:Dnah2	UTSW	11	69477683	missense	probably benign	0.07
R0924:Dnah2	UTSW	11	69421308	missense	probably damaging	1.00
R0968:Dnah2	UTSW	11	69448519	missense	possibly damaging	0.67
R1066:Dnah2	UTSW	11	69447819	missense	probably damaging	1.00
R1183:Dnah2	UTSW	11	69446648	missense	possibly damaging	0.95
R1184:Dnah2	UTSW	11	69499190	missense	probably damaging	1.00
R1186:Dnah2	UTSW	11	69515700	missense	probably damaging	0.99
R1453:Dnah2	UTSW	11	69451050	missense	probably damaging	0.99
R1498:Dnah2	UTSW	11	69520667	splice site	probably null
R1538:Dnah2	UTSW	11	69477202	missense	probably benign	0.17
R1574:Dnah2	UTSW	11	69514688	missense	probably benign	0.26
R1574:Dnah2	UTSW	11	69514688	missense	probably benign	0.26
R1590:Dnah2	UTSW	11	69422754	critical splice donor site	probably null
R1590:Dnah2	UTSW	11	69521198	missense	probably benign	0.00
R1655:Dnah2	UTSW	11	69473854	missense	probably damaging	1.00
R1695:Dnah2	UTSW	11	69514691	missense	possibly damaging	0.74
R1726:Dnah2	UTSW	11	69497889	missense	probably damaging	1.00
R1764:Dnah2	UTSW	11	69423543	missense	probably damaging	1.00
R1815:Dnah2	UTSW	11	69475574	missense	probably damaging	1.00
R1859:Dnah2	UTSW	11	69437886	missense	probably damaging	0.99
R1911:Dnah2	UTSW	11	69515752	missense	possibly damaging	0.64
R1913:Dnah2	UTSW	11	69464930	missense	probably damaging	1.00
R1981:Dnah2	UTSW	11	69474325	missense	probably damaging	1.00
R2010:Dnah2	UTSW	11	69458358	critical splice donor site	probably null
R2016:Dnah2	UTSW	11	69437070	missense	probably damaging	0.97
R2017:Dnah2	UTSW	11	69437070	missense	probably damaging	0.97
R2044:Dnah2	UTSW	11	69524240	missense	probably benign	0.14
R2077:Dnah2	UTSW	11	69496606	missense	possibly damaging	0.73
R2096:Dnah2	UTSW	11	69455916	missense	probably damaging	0.98
R2099:Dnah2	UTSW	11	69493237	missense	probably damaging	1.00
R2127:Dnah2	UTSW	11	69458185	missense	probably benign	0.02
R2128:Dnah2	UTSW	11	69458185	missense	probably benign	0.02
R2146:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2147:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2150:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2404:Dnah2	UTSW	11	69437221	missense	probably damaging	0.99
R2510:Dnah2	UTSW	11	69524206	nonsense	probably null
R2517:Dnah2	UTSW	11	69516644	missense	probably damaging	1.00
R3014:Dnah2	UTSW	11	69430478	missense	probably benign
R3741:Dnah2	UTSW	11	69448469	missense	probably damaging	1.00
R3814:Dnah2	UTSW	11	69492650	splice site	probably null
R3872:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3873:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3874:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3875:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3881:Dnah2	UTSW	11	69451347	missense	possibly damaging	0.94
R3953:Dnah2	UTSW	11	69454103	missense	probably damaging	1.00
R3956:Dnah2	UTSW	11	69484021	missense	probably benign	0.00
R4501:Dnah2	UTSW	11	69477659	missense	probably benign
R4515:Dnah2	UTSW	11	69465631	missense	possibly damaging	0.61
R4612:Dnah2	UTSW	11	69483367	missense	possibly damaging	0.93
R4625:Dnah2	UTSW	11	69463661	missense	probably damaging	1.00
R4627:Dnah2	UTSW	11	69465376	missense	probably damaging	1.00
R4642:Dnah2	UTSW	11	69496559	missense	probably benign	0.00
R4683:Dnah2	UTSW	11	69458942	missense	probably damaging	1.00
R4698:Dnah2	UTSW	11	69498532	missense	probably damaging	1.00
R4710:Dnah2	UTSW	11	69478077	missense	probably damaging	1.00
R4712:Dnah2	UTSW	11	69516590	missense	possibly damaging	0.47
R4713:Dnah2	UTSW	11	69476688	missense	probably damaging	1.00
R4717:Dnah2	UTSW	11	69429357	missense	probably benign	0.00
R4740:Dnah2	UTSW	11	69458042	missense	probably damaging	0.96
R4780:Dnah2	UTSW	11	69473871	missense	probably damaging	0.97
R4825:Dnah2	UTSW	11	69423205	missense	probably damaging	1.00
R4864:Dnah2	UTSW	11	69422590	missense	probably damaging	0.98
R4868:Dnah2	UTSW	11	69463648	missense	probably damaging	1.00
R4879:Dnah2	UTSW	11	69476691	missense	probably damaging	1.00
R4908:Dnah2	UTSW	11	69521147	missense	probably benign	0.00
R4911:Dnah2	UTSW	11	69499104	critical splice donor site	probably null
R4954:Dnah2	UTSW	11	69539496	missense	possibly damaging	0.61
R4962:Dnah2	UTSW	11	69455973	nonsense	probably null
R5015:Dnah2	UTSW	11	69497882	missense	possibly damaging	0.89
R5049:Dnah2	UTSW	11	69448166	missense	probably damaging	1.00
R5055:Dnah2	UTSW	11	69520773	missense	possibly damaging	0.67
R5153:Dnah2	UTSW	11	69520933	missense	possibly damaging	0.84
R5155:Dnah2	UTSW	11	69422536	missense	probably damaging	1.00
R5186:Dnah2	UTSW	11	69435884	missense	probably damaging	1.00
R5187:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5208:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5252:Dnah2	UTSW	11	69529469	missense	probably damaging	0.98
R5296:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5298:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5299:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5301:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5324:Dnah2	UTSW	11	69457993	missense	probably benign	0.07
R5350:Dnah2	UTSW	11	69516036	missense	possibly damaging	0.48
R5377:Dnah2	UTSW	11	69421848	missense	probably damaging	1.00
R5393:Dnah2	UTSW	11	69500857	missense	probably benign
R5421:Dnah2	UTSW	11	69435636	missense	probably damaging	1.00
R5452:Dnah2	UTSW	11	69524383	missense	probably damaging	1.00
R5461:Dnah2	UTSW	11	69473351	critical splice donor site	probably null
R5474:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5476:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5477:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5510:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5527:Dnah2	UTSW	11	69437188	nonsense	probably null
R5566:Dnah2	UTSW	11	69516569	nonsense	probably null
R5587:Dnah2	UTSW	11	69437242	missense	probably damaging	1.00
R5628:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5688:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5690:Dnah2	UTSW	11	69491544	missense	probably benign	0.15
R5711:Dnah2	UTSW	11	69435390	missense	probably damaging	1.00
R5735:Dnah2	UTSW	11	69430817	missense	possibly damaging	0.93
R5826:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5913:Dnah2	UTSW	11	69448430	missense	probably damaging	1.00
R5914:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5960:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5961:Dnah2	UTSW	11	69431148	missense	probably damaging	1.00
R5961:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5977:Dnah2	UTSW	11	69520881	missense	possibly damaging	0.79
R6020:Dnah2	UTSW	11	69500839	missense	probably benign
R6036:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6036:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6050:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6086:Dnah2	UTSW	11	69516008	missense	probably benign	0.30
R6115:Dnah2	UTSW	11	69446649	missense	probably damaging	1.00
R6123:Dnah2	UTSW	11	69518359	missense	probably benign	0.29
R6159:Dnah2	UTSW	11	69458542	missense	probably damaging	1.00
R6159:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6163:Dnah2	UTSW	11	69520903	nonsense	probably null
R6171:Dnah2	UTSW	11	69423042	missense	probably damaging	1.00
R6263:Dnah2	UTSW	11	69457412	missense	probably damaging	1.00
R6298:Dnah2	UTSW	11	69491641	missense	probably benign	0.25
R6352:Dnah2	UTSW	11	69448227	missense	probably damaging	1.00
R6399:Dnah2	UTSW	11	69458518	missense	probably damaging	0.98
R6466:Dnah2	UTSW	11	69539415	missense	probably benign
R6478:Dnah2	UTSW	11	69516010	missense	probably benign	0.01
R6516:Dnah2	UTSW	11	69465386	missense	probably benign	0.34
R6538:Dnah2	UTSW	11	69437197	missense	possibly damaging	0.87
R6802:Dnah2	UTSW	11	69423690	missense	probably damaging	1.00
R6861:Dnah2	UTSW	11	69455963	missense	possibly damaging	0.64
R6869:Dnah2	UTSW	11	69429471	missense	probably damaging	1.00
R6894:Dnah2	UTSW	11	69484260	missense	probably benign	0.12
R6935:Dnah2	UTSW	11	69421741	missense	probably damaging	1.00
R7017:Dnah2	UTSW	11	69491547	nonsense	probably null
R7073:Dnah2	UTSW	11	69430492	nonsense	probably null
R7111:Dnah2	UTSW	11	69446753	splice site	probably null
R7125:Dnah2	UTSW	11	69436182	missense	probably damaging	0.99
R7137:Dnah2	UTSW	11	69491555	missense	probably damaging	1.00
R7190:Dnah2	UTSW	11	69549097	splice site	probably null
R7214:Dnah2	UTSW	11	69431109	missense	probably damaging	1.00
R7227:Dnah2	UTSW	11	69421396	missense	probably damaging	0.99
R7238:Dnah2	UTSW	11	69459146	critical splice donor site	probably null
R7256:Dnah2	UTSW	11	69431094	missense	probably damaging	1.00
R7267:Dnah2	UTSW	11	69500817	missense	probably damaging	1.00
R7420:Dnah2	UTSW	11	69478797	missense	possibly damaging	0.94
R7421:Dnah2	UTSW	11	69492805	missense	probably benign	0.25
R7437:Dnah2	UTSW	11	69498627	missense	probably damaging	1.00
R7461:Dnah2	UTSW	11	69548990	critical splice donor site	probably null
R7473:Dnah2	UTSW	11	69491658	missense	probably damaging	0.99
R7528:Dnah2	UTSW	11	69500796	missense	probably damaging	0.99
R7613:Dnah2	UTSW	11	69548990	critical splice donor site	probably null
R7615:Dnah2	UTSW	11	69435304	missense	probably damaging	0.99
R7626:Dnah2	UTSW	11	69498685	missense	probably damaging	0.99
R7745:Dnah2	UTSW	11	69451318	nonsense	probably null
R7764:Dnah2	UTSW	11	69458158	missense	probably benign	0.29
R7793:Dnah2	UTSW	11	69495214	missense	probably benign	0.00
R7819:Dnah2	UTSW	11	69516593	missense	probably benign	0.01
R7881:Dnah2	UTSW	11	69431238	missense	probably damaging	1.00
R7900:Dnah2	UTSW	11	69518428	missense	probably damaging	1.00
R7916:Dnah2	UTSW	11	69421148	critical splice acceptor site	probably null
R7921:Dnah2	UTSW	11	69520834	missense	probably benign
R7928:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
R7937:Dnah2	UTSW	11	69517685	nonsense	probably null
R7995:Dnah2	UTSW	11	69520737	missense	possibly damaging	0.77
R8202:Dnah2	UTSW	11	69478823	missense	probably benign	0.00
R8208:Dnah2	UTSW	11	69520852	missense	probably benign	0.05
R8215:Dnah2	UTSW	11	69435367	missense	probably damaging	1.00
R8279:Dnah2	UTSW	11	69475573	missense	probably damaging	1.00
R8338:Dnah2	UTSW	11	69487296	missense	probably damaging	1.00
R8348:Dnah2	UTSW	11	69429447	missense	possibly damaging	0.95
R8405:Dnah2	UTSW	11	69458463	missense	probably damaging	1.00
R8407:Dnah2	UTSW	11	69459278	missense	probably benign	0.00
R8493:Dnah2	UTSW	11	69452978	missense	probably damaging	1.00
R8673:Dnah2	UTSW	11	69514697	missense	probably benign	0.23
R8725:Dnah2	UTSW	11	69524179	missense	probably damaging	1.00
R8727:Dnah2	UTSW	11	69524179	missense	probably damaging	1.00
R8730:Dnah2	UTSW	11	69493261	missense	possibly damaging	0.73
R8804:Dnah2	UTSW	11	69465685	missense	probably benign	0.01
R8876:Dnah2	UTSW	11	69491522	missense	probably damaging	1.00
R8894:Dnah2	UTSW	11	69492222	missense	probably benign	0.01
R8938:Dnah2	UTSW	11	69437928	missense	probably damaging	0.99
R9044:Dnah2	UTSW	11	69529421	missense	probably benign
R9085:Dnah2	UTSW	11	69429398	missense	possibly damaging	0.69
R9110:Dnah2	UTSW	11	69544382	missense	probably benign
R9156:Dnah2	UTSW	11	69422861	missense
R9251:Dnah2	UTSW	11	69515793	missense	probably damaging	1.00
R9258:Dnah2	UTSW	11	69477253	missense	probably damaging	1.00
R9279:Dnah2	UTSW	11	69518278	missense	probably benign	0.01
R9318:Dnah2	UTSW	11	69484329	missense	probably benign	0.07
R9321:Dnah2	UTSW	11	69448113	critical splice donor site	probably null
R9350:Dnah2	UTSW	11	69493247	missense	probably benign	0.10
R9358:Dnah2	UTSW	11	69515766	missense	probably damaging	0.99
R9417:Dnah2	UTSW	11	69436164	missense	probably damaging	1.00
R9420:Dnah2	UTSW	11	69478116	missense	probably benign	0.09
R9438:Dnah2	UTSW	11	69473394	missense	probably damaging	1.00
R9469:Dnah2	UTSW	11	69431070	missense	probably damaging	1.00
R9487:Dnah2	UTSW	11	69515791	missense	possibly damaging	0.47
R9495:Dnah2	UTSW	11	69454382	missense	possibly damaging	0.89
R9579:Dnah2	UTSW	11	69477215	missense	probably damaging	1.00
R9608:Dnah2	UTSW	11	69454062	missense	probably null	1.00
R9651:Dnah2	UTSW	11	69450998	critical splice donor site	probably null
R9662:Dnah2	UTSW	11	69452937	missense	probably benign
RF004:Dnah2	UTSW	11	69437187	missense	probably benign	0.24
U24488:Dnah2	UTSW	11	69483822	missense	probably damaging	0.99
X0021:Dnah2	UTSW	11	69448562	missense	possibly damaging	0.81
Z1088:Dnah2	UTSW	11	69430793	missense	probably damaging	1.00
Z1176:Dnah2	UTSW	11	69421821	missense	possibly damaging	0.46
Z1176:Dnah2	UTSW	11	69451120	missense	probably benign
Z1176:Dnah2	UTSW	11	69487054	missense	possibly damaging	0.46
Z1176:Dnah2	UTSW	11	69498667	missense	probably benign	0.12
Z1176:Dnah2	UTSW	11	69516481	missense	probably damaging	1.00
Z1176:Dnah2	UTSW	11	69516523	missense	probably damaging	1.00
Z1177:Dnah2	UTSW	11	69463453	missense	possibly damaging	0.63
Z1177:Dnah2	UTSW	11	69544557	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCAAGATGGGAGTTAAGGTCTTG -3'
(R):5'- CTGAACTAGAAGCCCTCAGG -3'

Sequencing Primer
(F):5'- AGTTAAGGTCTTGGGAGAGTGAG -3'
(R):5'- ACCTTCACAGTGTGGCGTC -3'

Posted On

2014-06-23