Incidental Mutation 'R1822:Dock8'
ID 206529
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms 1200017A24Rik, 5830472H07Rik, A130095G14Rik
MMRRC Submission 039850-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R1822 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 24976898-25179796 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25138422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1249 (E1249G)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: E1249G

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: E1249G

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.1329 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (105/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,847,901 (GRCm39) T798K possibly damaging Het
Abtb1 T C 6: 88,813,536 (GRCm39) T401A probably benign Het
Adsl G T 15: 80,846,943 (GRCm39) E70* probably null Het
Ahcyl2 A G 6: 29,768,583 (GRCm39) probably benign Het
Akr1a1 A G 4: 116,493,850 (GRCm39) V310A probably benign Het
Alpk3 T A 7: 80,726,679 (GRCm39) C121* probably null Het
Amph T A 13: 19,132,625 (GRCm39) I8N probably damaging Het
Ano2 G A 6: 125,840,420 (GRCm39) A364T probably damaging Het
Apbb2 T C 5: 66,557,520 (GRCm39) T314A probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atf7ip A G 6: 136,564,258 (GRCm39) T834A probably benign Het
Brca2 T G 5: 150,463,663 (GRCm39) D1142E probably benign Het
Brd10 T C 19: 29,693,814 (GRCm39) N1960S probably damaging Het
Cap2 A G 13: 46,768,823 (GRCm39) S210G probably benign Het
Capn2 C A 1: 182,300,525 (GRCm39) E596D possibly damaging Het
Cdc27 A T 11: 104,413,648 (GRCm39) S358R probably benign Het
Cdhr3 C T 12: 33,095,204 (GRCm39) G622S probably null Het
Clip2 A G 5: 134,532,081 (GRCm39) Y540H probably benign Het
Crhr1 A T 11: 104,023,898 (GRCm39) M1L probably benign Het
Csmd1 T C 8: 16,273,340 (GRCm39) T831A probably damaging Het
Cwc22 T C 2: 77,755,003 (GRCm39) probably benign Het
Cyp3a25 T A 5: 145,921,763 (GRCm39) K390N probably damaging Het
Cyp4a31 T C 4: 115,423,810 (GRCm39) probably null Het
Cytip A C 2: 58,024,158 (GRCm39) S221A probably benign Het
Dagla G A 19: 10,240,550 (GRCm39) R227C possibly damaging Het
Dhx57 A G 17: 80,560,514 (GRCm39) probably null Het
Dnah2 A T 11: 69,405,630 (GRCm39) D627E probably damaging Het
Dpysl3 A G 18: 43,475,393 (GRCm39) V31A probably benign Het
Ecpas A G 4: 58,805,539 (GRCm39) probably null Het
Fan1 T C 7: 64,022,554 (GRCm39) N233S probably benign Het
Fras1 A T 5: 96,918,547 (GRCm39) I3528F probably damaging Het
Glipr1 T A 10: 111,832,765 (GRCm39) M58L possibly damaging Het
Gm10509 C T 17: 21,909,765 (GRCm39) P31S possibly damaging Het
Gm5070 T C 3: 95,318,355 (GRCm39) noncoding transcript Het
Gramd1a T C 7: 30,841,998 (GRCm39) N138S probably damaging Het
Grk5 T C 19: 61,078,410 (GRCm39) V489A probably damaging Het
Hmcn2 C T 2: 31,273,704 (GRCm39) S1352L probably damaging Het
Hoxa5 G A 6: 52,179,712 (GRCm39) T221I probably damaging Het
Hsd17b2 C A 8: 118,485,488 (GRCm39) P317Q possibly damaging Het
Ifi213 T A 1: 173,417,408 (GRCm39) S335C probably damaging Het
Izumo4 A T 10: 80,539,729 (GRCm39) D156V probably damaging Het
Khnyn A T 14: 56,123,309 (GRCm39) E21V probably damaging Het
Kmt2d C T 15: 98,759,661 (GRCm39) G1199E unknown Het
Lipk T C 19: 34,016,491 (GRCm39) W240R probably benign Het
Lpar5 A G 6: 125,058,378 (GRCm39) D33G possibly damaging Het
Lrp11 A G 10: 7,471,961 (GRCm39) D219G probably damaging Het
Lrrcc1 T C 3: 14,624,285 (GRCm39) probably benign Het
Man2a1 T C 17: 65,047,837 (GRCm39) C252R probably damaging Het
Map2k5 A G 9: 63,142,585 (GRCm39) F354L possibly damaging Het
Mlh3 T C 12: 85,312,919 (GRCm39) probably benign Het
Mmp28 A G 11: 83,335,045 (GRCm39) I331T probably damaging Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Nckap1 A G 2: 80,348,242 (GRCm39) S898P possibly damaging Het
Nectin1 T A 9: 43,702,374 (GRCm39) Y40* probably null Het
Neurl1a T A 19: 47,245,898 (GRCm39) V493E probably benign Het
Ntf3 A C 6: 126,079,209 (GRCm39) I99S probably benign Het
Or10ag53 T C 2: 87,083,054 (GRCm39) S258P possibly damaging Het
Or1l4 C G 2: 37,091,992 (GRCm39) H246Q probably damaging Het
Or1p1c A G 11: 74,161,066 (GRCm39) T284A probably benign Het
Or2ak5 A T 11: 58,611,133 (GRCm39) V247E probably damaging Het
Or2i1 A G 17: 37,507,722 (GRCm39) probably benign Het
Or2y1c T A 11: 49,361,795 (GRCm39) F272L probably benign Het
Or6k8-ps1 C T 1: 173,979,780 (GRCm39) R233C probably benign Het
Otof G A 5: 30,536,054 (GRCm39) T1343I probably benign Het
Otop2 A T 11: 115,215,454 (GRCm39) Y125F probably benign Het
Pate3 G A 9: 35,557,401 (GRCm39) T85I probably benign Het
Pdpk1 A T 17: 24,317,150 (GRCm39) probably benign Het
Phf11d T C 14: 59,593,778 (GRCm39) H132R probably benign Het
Pik3c3 G A 18: 30,477,130 (GRCm39) probably null Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Prkdc G A 16: 15,577,469 (GRCm39) D2372N probably damaging Het
Ptprq C T 10: 107,554,339 (GRCm39) E129K probably damaging Het
Pym1 G A 10: 128,601,913 (GRCm39) probably benign Het
Ralgapb T A 2: 158,334,372 (GRCm39) V1027E probably damaging Het
Rita1 T C 5: 120,747,645 (GRCm39) T218A possibly damaging Het
Rrh T A 3: 129,606,282 (GRCm39) T218S probably damaging Het
Scaper C T 9: 55,767,184 (GRCm39) A416T probably damaging Het
Scn3a A G 2: 65,314,716 (GRCm39) L1115P probably damaging Het
Serpinb6e A T 13: 34,017,217 (GRCm39) S268T probably damaging Het
Skic3 C A 13: 76,278,407 (GRCm39) H574N probably benign Het
Slc1a6 G A 10: 78,648,765 (GRCm39) W495* probably null Het
Slc32a1 A G 2: 158,453,298 (GRCm39) H46R probably benign Het
Slc37a1 C T 17: 31,519,405 (GRCm39) probably benign Het
Slc6a5 T A 7: 49,606,173 (GRCm39) W694R probably benign Het
Smarcd2 A T 11: 106,158,222 (GRCm39) D113E probably benign Het
Sod3 G T 5: 52,525,504 (GRCm39) V68L probably benign Het
Srpk3 G A X: 72,821,561 (GRCm39) R425Q possibly damaging Het
Sspo A T 6: 48,469,820 (GRCm39) Q4506L possibly damaging Het
Stam2 T A 2: 52,606,539 (GRCm39) E115D probably damaging Het
Sult1c2 A T 17: 54,280,953 (GRCm39) L50H probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Togaram1 T G 12: 65,042,409 (GRCm39) V1156G probably damaging Het
Tpp1 T C 7: 105,398,854 (GRCm39) T192A probably benign Het
Ush1c A G 7: 45,859,325 (GRCm39) L498P probably damaging Het
Vit A C 17: 78,930,265 (GRCm39) Q410P probably benign Het
Vmn2r27 C T 6: 124,208,593 (GRCm39) G51S probably benign Het
Zfp341 A G 2: 154,488,054 (GRCm39) E839G possibly damaging Het
Zhx3 G A 2: 160,622,275 (GRCm39) L631F probably benign Het
Zmpste24 T C 4: 120,944,513 (GRCm39) E95G possibly damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25,105,076 (GRCm39) critical splice donor site probably benign
primurus APN 19 25,160,973 (GRCm39) missense probably damaging 1.00
IGL00737:Dock8 APN 19 25,160,340 (GRCm39) missense probably benign 0.00
IGL00755:Dock8 APN 19 25,028,873 (GRCm39) missense probably benign 0.09
IGL00822:Dock8 APN 19 25,165,773 (GRCm39) nonsense probably null
IGL00838:Dock8 APN 19 25,152,823 (GRCm39) nonsense probably null
IGL01419:Dock8 APN 19 25,096,816 (GRCm39) missense probably benign 0.08
IGL01456:Dock8 APN 19 25,096,863 (GRCm39) missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25,146,805 (GRCm39) missense probably damaging 0.99
IGL01602:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01605:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01753:Dock8 APN 19 25,038,656 (GRCm39) splice site probably benign
IGL01843:Dock8 APN 19 25,067,292 (GRCm39) missense probably benign 0.02
IGL02032:Dock8 APN 19 25,107,769 (GRCm39) missense probably damaging 0.99
IGL02073:Dock8 APN 19 25,178,350 (GRCm39) critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25,055,569 (GRCm39) critical splice donor site probably null
IGL02402:Dock8 APN 19 25,055,509 (GRCm39) missense probably benign 0.25
IGL02529:Dock8 APN 19 25,078,290 (GRCm39) nonsense probably null
IGL02728:Dock8 APN 19 25,109,584 (GRCm39) missense probably benign
IGL02739:Dock8 APN 19 25,165,852 (GRCm39) missense probably damaging 1.00
IGL03037:Dock8 APN 19 25,063,545 (GRCm39) missense probably benign 0.02
IGL03104:Dock8 APN 19 25,178,384 (GRCm39) nonsense probably null
IGL03137:Dock8 APN 19 25,133,312 (GRCm39) missense probably benign 0.19
IGL03365:Dock8 APN 19 25,077,048 (GRCm39) missense possibly damaging 0.70
Defenseless UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
Guardate UTSW 19 25,127,195 (GRCm39) missense probably benign
hillock UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
Molehill UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
Pap UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
Papilla UTSW 19 25,055,448 (GRCm39) nonsense probably null
snowdrop UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
warts_and_all UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R0021:Dock8 UTSW 19 25,140,411 (GRCm39) missense probably benign 0.01
R0147:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0148:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0294:Dock8 UTSW 19 25,165,714 (GRCm39) missense probably damaging 1.00
R0537:Dock8 UTSW 19 25,148,941 (GRCm39) missense probably benign 0.08
R0630:Dock8 UTSW 19 25,038,524 (GRCm39) missense probably benign 0.10
R1163:Dock8 UTSW 19 25,028,867 (GRCm39) missense probably benign
R1164:Dock8 UTSW 19 25,067,391 (GRCm39) missense probably benign 0.44
R1471:Dock8 UTSW 19 25,178,400 (GRCm39) missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
R1803:Dock8 UTSW 19 25,109,599 (GRCm39) missense probably benign 0.00
R1852:Dock8 UTSW 19 25,104,492 (GRCm39) missense probably benign 0.45
R1916:Dock8 UTSW 19 25,038,521 (GRCm39) missense probably benign 0.02
R1984:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R2311:Dock8 UTSW 19 25,160,368 (GRCm39) missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25,177,757 (GRCm39) missense probably damaging 0.99
R2483:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3116:Dock8 UTSW 19 25,165,858 (GRCm39) missense probably benign 0.00
R3157:Dock8 UTSW 19 25,127,195 (GRCm39) missense probably benign
R3623:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3624:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3800:Dock8 UTSW 19 25,141,716 (GRCm39) missense probably benign 0.08
R3844:Dock8 UTSW 19 25,042,794 (GRCm39) nonsense probably null
R3895:Dock8 UTSW 19 25,028,865 (GRCm39) missense probably benign 0.31
R3901:Dock8 UTSW 19 25,078,269 (GRCm39) missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
R4428:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4428:Dock8 UTSW 19 25,177,863 (GRCm39) missense probably damaging 0.98
R4429:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4431:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4545:Dock8 UTSW 19 25,165,722 (GRCm39) missense probably damaging 1.00
R4839:Dock8 UTSW 19 25,146,858 (GRCm39) missense probably benign 0.00
R4897:Dock8 UTSW 19 25,159,001 (GRCm39) missense probably benign 0.00
R4939:Dock8 UTSW 19 25,099,764 (GRCm39) missense probably damaging 1.00
R4995:Dock8 UTSW 19 25,135,747 (GRCm39) missense probably benign 0.02
R5035:Dock8 UTSW 19 25,063,571 (GRCm39) missense probably damaging 0.99
R5294:Dock8 UTSW 19 25,038,517 (GRCm39) missense probably benign 0.01
R5324:Dock8 UTSW 19 25,140,458 (GRCm39) missense probably benign 0.17
R5478:Dock8 UTSW 19 25,057,186 (GRCm39) missense probably benign
R5704:Dock8 UTSW 19 25,151,586 (GRCm39) missense probably damaging 1.00
R5724:Dock8 UTSW 19 25,099,785 (GRCm39) missense probably damaging 1.00
R5745:Dock8 UTSW 19 25,107,761 (GRCm39) missense probably benign 0.02
R5864:Dock8 UTSW 19 25,038,584 (GRCm39) missense probably damaging 0.99
R5870:Dock8 UTSW 19 25,109,490 (GRCm39) missense probably benign
R5893:Dock8 UTSW 19 25,099,811 (GRCm39) missense probably damaging 1.00
R5954:Dock8 UTSW 19 25,148,983 (GRCm39) missense probably damaging 1.00
R6087:Dock8 UTSW 19 25,138,438 (GRCm39) missense probably benign 0.00
R6223:Dock8 UTSW 19 25,138,416 (GRCm39) missense probably benign 0.00
R6391:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25,104,848 (GRCm39) missense probably damaging 0.99
R6786:Dock8 UTSW 19 25,160,386 (GRCm39) missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
R6818:Dock8 UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R6885:Dock8 UTSW 19 25,124,742 (GRCm39) missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25,165,746 (GRCm39) missense probably damaging 1.00
R6923:Dock8 UTSW 19 25,072,970 (GRCm39) missense probably benign
R7001:Dock8 UTSW 19 25,077,041 (GRCm39) missense probably benign
R7141:Dock8 UTSW 19 25,158,984 (GRCm39) missense probably null 0.75
R7203:Dock8 UTSW 19 25,158,927 (GRCm39) missense probably damaging 1.00
R7257:Dock8 UTSW 19 25,104,449 (GRCm39) missense probably benign 0.08
R7296:Dock8 UTSW 19 25,162,245 (GRCm39) missense probably benign 0.00
R7538:Dock8 UTSW 19 25,135,782 (GRCm39) missense probably damaging 1.00
R7555:Dock8 UTSW 19 25,152,764 (GRCm39) missense probably damaging 0.99
R7641:Dock8 UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
R7764:Dock8 UTSW 19 25,074,899 (GRCm39) missense probably benign
R7859:Dock8 UTSW 19 25,160,934 (GRCm39) missense probably damaging 1.00
R7864:Dock8 UTSW 19 25,140,864 (GRCm39) missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25,131,606 (GRCm39) missense probably damaging 1.00
R8160:Dock8 UTSW 19 25,124,711 (GRCm39) missense probably damaging 1.00
R8287:Dock8 UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
R8295:Dock8 UTSW 19 25,100,600 (GRCm39) missense probably benign 0.04
R8443:Dock8 UTSW 19 25,133,281 (GRCm39) missense probably benign 0.04
R8537:Dock8 UTSW 19 25,107,870 (GRCm39) missense probably benign 0.00
R8673:Dock8 UTSW 19 25,160,867 (GRCm39) missense probably damaging 0.96
R8709:Dock8 UTSW 19 25,055,448 (GRCm39) nonsense probably null
R8834:Dock8 UTSW 19 25,140,834 (GRCm39) missense probably benign 0.16
R8991:Dock8 UTSW 19 25,165,731 (GRCm39) missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25,160,995 (GRCm39) splice site probably benign
R9509:Dock8 UTSW 19 25,072,985 (GRCm39) missense probably benign 0.00
R9526:Dock8 UTSW 19 25,165,739 (GRCm39) missense probably benign 0.10
R9622:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R9634:Dock8 UTSW 19 25,169,585 (GRCm39) missense probably damaging 1.00
R9654:Dock8 UTSW 19 25,124,710 (GRCm39) missense probably damaging 1.00
R9670:Dock8 UTSW 19 25,148,926 (GRCm39) missense probably null 0.01
R9699:Dock8 UTSW 19 25,133,388 (GRCm39) critical splice donor site probably null
R9726:Dock8 UTSW 19 25,154,374 (GRCm39) missense probably damaging 0.97
R9765:Dock8 UTSW 19 25,146,832 (GRCm39) missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25,138,493 (GRCm39) missense probably benign
Z1177:Dock8 UTSW 19 25,133,336 (GRCm39) missense probably benign 0.16
Z1177:Dock8 UTSW 19 25,109,487 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAGCTCATAGCCTAAGCGTATGC -3'
(R):5'- AGGCTGGGTTCTATCAGAAGTTTAG -3'

Sequencing Primer
(F):5'- AGCCTGTCTGCTTTTTCTATATATG -3'
(R):5'- TTTAGGAGGAGGTGACATCAAC -3'
Posted On 2014-06-23