Incidental Mutation 'R0114:Fanca'
ID 20653
Institutional Source Beutler Lab
Gene Symbol Fanca
Ensembl Gene ENSMUSG00000032815
Gene Name Fanconi anemia, complementation group A
Synonyms
MMRRC Submission 038400-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.714) question?
Stock # R0114 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 123995039-124045315 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 124015230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035495] [ENSMUST00000035495] [ENSMUST00000035495] [ENSMUST00000127664] [ENSMUST00000127904] [ENSMUST00000127904] [ENSMUST00000127904]
AlphaFold Q9JL70
Predicted Effect probably null
Transcript: ENSMUST00000035495
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000035495
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000035495
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127904
SMART Domains Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 547 562 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127904
SMART Domains Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 547 562 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127904
SMART Domains Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 547 562 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212953
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,861,978 (GRCm39) probably benign Het
4933427D14Rik T C 11: 72,086,625 (GRCm39) Y262C probably damaging Het
Adamts1 C A 16: 85,596,502 (GRCm39) V379L probably benign Het
Akt3 T C 1: 176,894,817 (GRCm39) D260G probably damaging Het
Alms1 T C 6: 85,596,785 (GRCm39) L537P probably benign Het
Anln A T 9: 22,264,642 (GRCm39) I876N probably damaging Het
Ano9 A T 7: 140,683,152 (GRCm39) probably benign Het
Arhgef10l T C 4: 140,311,194 (GRCm39) E218G probably benign Het
Arnt2 G A 7: 83,996,738 (GRCm39) R63C probably damaging Het
Atp9a G T 2: 168,552,776 (GRCm39) Y63* probably null Het
Bmpr2 G T 1: 59,854,499 (GRCm39) C116F probably damaging Het
Cand1 T C 10: 119,052,427 (GRCm39) D233G probably benign Het
Cftr A T 6: 18,282,447 (GRCm39) H1049L probably damaging Het
Ckap5 A T 2: 91,450,457 (GRCm39) D1975V possibly damaging Het
Cyp26c1 T C 19: 37,675,081 (GRCm39) V134A probably benign Het
Dnai1 T C 4: 41,605,686 (GRCm39) probably benign Het
Dpp10 T C 1: 123,413,821 (GRCm39) I163V probably benign Het
Fam151a A T 4: 106,591,201 (GRCm39) I15F possibly damaging Het
Fes A G 7: 80,027,783 (GRCm39) V787A probably damaging Het
Fnip1 C T 11: 54,378,627 (GRCm39) probably benign Het
Gabpb1 A G 2: 126,495,494 (GRCm39) I86T probably damaging Het
Gmds A T 13: 32,411,264 (GRCm39) S57T probably benign Het
Gnpat T G 8: 125,610,096 (GRCm39) D426E probably benign Het
Gnptab C A 10: 88,269,262 (GRCm39) P655Q possibly damaging Het
Gpi-ps A G 8: 5,690,359 (GRCm39) noncoding transcript Het
Herc1 T A 9: 66,369,128 (GRCm39) F2941I probably damaging Het
Herc2 T C 7: 55,803,522 (GRCm39) probably benign Het
Ino80 G A 2: 119,213,441 (GRCm39) R1249C probably damaging Het
Itga11 T G 9: 62,642,575 (GRCm39) V166G probably damaging Het
Itga11 T C 9: 62,667,584 (GRCm39) V639A possibly damaging Het
Itpr2 A G 6: 146,214,377 (GRCm39) F1490S probably damaging Het
Lama2 C A 10: 26,869,064 (GRCm39) E802* probably null Het
Lgi3 C T 14: 70,768,469 (GRCm39) probably benign Het
Limch1 C T 5: 67,193,427 (GRCm39) probably benign Het
Lipc T C 9: 70,711,063 (GRCm39) N363S probably damaging Het
Lrit2 A G 14: 36,790,002 (GRCm39) probably null Het
Mfsd13a C T 19: 46,354,943 (GRCm39) T40I probably benign Het
Mug2 A G 6: 122,017,607 (GRCm39) Y448C probably damaging Het
Mybpc3 A G 2: 90,954,839 (GRCm39) E450G probably damaging Het
Myo5b A T 18: 74,875,242 (GRCm39) T1549S probably benign Het
Naa15 T C 3: 51,355,859 (GRCm39) probably null Het
Nckap1l T A 15: 103,363,455 (GRCm39) C54S probably benign Het
Nlrp9b A G 7: 19,757,981 (GRCm39) D406G probably benign Het
Nprl3 T A 11: 32,189,784 (GRCm39) probably benign Het
Nvl A G 1: 180,947,956 (GRCm39) V429A probably benign Het
Opa1 A T 16: 29,448,453 (GRCm39) N912Y probably benign Het
Or14j3 A T 17: 37,900,306 (GRCm39) *313K probably null Het
Or1x2 G A 11: 50,918,431 (GRCm39) V201I probably benign Het
Or52b4i A T 7: 102,191,938 (GRCm39) Q265L probably benign Het
Or6c211 T A 10: 129,505,467 (GRCm39) Y307F probably benign Het
Pcnx1 T C 12: 82,042,869 (GRCm39) V2317A possibly damaging Het
Phf3 A T 1: 30,844,524 (GRCm39) N1478K possibly damaging Het
Phykpl G A 11: 51,477,480 (GRCm39) D91N probably benign Het
Polr2b T A 5: 77,491,110 (GRCm39) C984S probably damaging Het
Ppfibp1 A G 6: 146,899,731 (GRCm39) R141G probably benign Het
Ppm1d G A 11: 85,217,731 (GRCm39) G20R probably damaging Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Ppp2r5b C A 19: 6,278,461 (GRCm39) V483F probably benign Het
Ppp4r4 T A 12: 103,542,633 (GRCm39) C132S probably benign Het
Prg2 A G 2: 84,813,800 (GRCm39) probably benign Het
Prpf4b G A 13: 35,074,471 (GRCm39) probably benign Het
Rad54l2 T C 9: 106,590,654 (GRCm39) T491A probably damaging Het
Rnf213 G T 11: 119,305,413 (GRCm39) W548L probably damaging Het
Rusc2 G T 4: 43,422,055 (GRCm39) C825F probably damaging Het
Sema4b A G 7: 79,868,826 (GRCm39) probably benign Het
Sema6a A G 18: 47,423,244 (GRCm39) V254A probably damaging Het
Slc13a3 A G 2: 165,266,501 (GRCm39) F346L probably damaging Het
Slc25a17 T C 15: 81,222,160 (GRCm39) D104G probably damaging Het
Specc1 A T 11: 62,037,139 (GRCm39) N707Y possibly damaging Het
Tex48 T A 4: 63,526,696 (GRCm39) E76V probably damaging Het
Tfr2 T C 5: 137,575,727 (GRCm39) V281A probably benign Het
Tgfb1i1 A C 7: 127,848,666 (GRCm39) Q238H probably damaging Het
Thoc6 G A 17: 23,889,213 (GRCm39) T122I probably benign Het
Tmtc1 G A 6: 148,314,328 (GRCm39) probably benign Het
Tnfrsf8 T C 4: 145,014,617 (GRCm39) D264G possibly damaging Het
Trim43a T A 9: 88,466,213 (GRCm39) I178N probably damaging Het
Ttn G C 2: 76,537,437 (GRCm39) I26503M possibly damaging Het
Usp28 C A 9: 48,950,323 (GRCm39) D589E probably benign Het
Utp23 T C 15: 51,745,907 (GRCm39) S242P probably damaging Het
Vwa3a A G 7: 120,374,603 (GRCm39) Y305C probably benign Het
Vwa5b1 C A 4: 138,336,169 (GRCm39) E142* probably null Het
Xrn2 A T 2: 146,871,699 (GRCm39) T374S probably damaging Het
Zfp735 A T 11: 73,601,488 (GRCm39) Q144L probably benign Het
Other mutations in Fanca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02348:Fanca APN 8 124,032,002 (GRCm39) missense probably damaging 1.00
IGL02805:Fanca APN 8 124,016,233 (GRCm39) missense probably damaging 0.99
IGL03280:Fanca APN 8 124,043,198 (GRCm39) unclassified probably benign
PIT4402001:Fanca UTSW 8 124,039,803 (GRCm39) missense possibly damaging 0.83
R0115:Fanca UTSW 8 123,995,278 (GRCm39) missense probably benign 0.00
R0271:Fanca UTSW 8 123,999,180 (GRCm39) unclassified probably benign
R0330:Fanca UTSW 8 124,000,911 (GRCm39) nonsense probably null
R0345:Fanca UTSW 8 124,031,552 (GRCm39) missense probably damaging 1.00
R0570:Fanca UTSW 8 124,033,169 (GRCm39) missense probably benign 0.01
R0601:Fanca UTSW 8 124,035,252 (GRCm39) missense probably damaging 0.99
R0617:Fanca UTSW 8 124,014,809 (GRCm39) missense probably damaging 0.99
R0639:Fanca UTSW 8 124,016,098 (GRCm39) critical splice donor site probably null
R0943:Fanca UTSW 8 124,000,925 (GRCm39) missense probably damaging 1.00
R1140:Fanca UTSW 8 124,039,868 (GRCm39) splice site probably null
R1364:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1366:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1367:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1368:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1969:Fanca UTSW 8 124,014,803 (GRCm39) missense probably benign 0.41
R1992:Fanca UTSW 8 124,024,551 (GRCm39) missense possibly damaging 0.94
R2060:Fanca UTSW 8 124,001,220 (GRCm39) missense probably damaging 1.00
R2174:Fanca UTSW 8 123,998,009 (GRCm39) missense probably benign 0.00
R2261:Fanca UTSW 8 124,016,098 (GRCm39) critical splice donor site probably null
R3957:Fanca UTSW 8 124,043,102 (GRCm39) missense probably benign 0.00
R4062:Fanca UTSW 8 124,001,911 (GRCm39) missense probably benign 0.00
R4153:Fanca UTSW 8 124,031,617 (GRCm39) missense possibly damaging 0.89
R4270:Fanca UTSW 8 123,995,533 (GRCm39) missense probably damaging 1.00
R4424:Fanca UTSW 8 124,015,532 (GRCm39) missense probably benign 0.11
R4581:Fanca UTSW 8 124,001,077 (GRCm39) splice site probably null
R4639:Fanca UTSW 8 124,044,889 (GRCm39) missense probably damaging 0.98
R4664:Fanca UTSW 8 123,995,711 (GRCm39) missense probably damaging 0.99
R4665:Fanca UTSW 8 123,995,711 (GRCm39) missense probably damaging 0.99
R4666:Fanca UTSW 8 123,995,711 (GRCm39) missense probably damaging 0.99
R4686:Fanca UTSW 8 123,995,673 (GRCm39) splice site probably benign
R4775:Fanca UTSW 8 124,023,045 (GRCm39) missense probably damaging 0.99
R4782:Fanca UTSW 8 124,014,941 (GRCm39) missense probably damaging 1.00
R4799:Fanca UTSW 8 124,014,941 (GRCm39) missense probably damaging 1.00
R4926:Fanca UTSW 8 124,030,724 (GRCm39) missense probably benign 0.05
R4973:Fanca UTSW 8 124,035,261 (GRCm39) missense probably damaging 0.96
R5039:Fanca UTSW 8 124,010,785 (GRCm39) missense probably benign
R5195:Fanca UTSW 8 124,030,684 (GRCm39) intron probably benign
R5590:Fanca UTSW 8 124,030,702 (GRCm39) intron probably benign
R5848:Fanca UTSW 8 124,021,792 (GRCm39) intron probably benign
R5965:Fanca UTSW 8 124,043,149 (GRCm39) missense possibly damaging 0.46
R6224:Fanca UTSW 8 124,032,020 (GRCm39) missense possibly damaging 0.87
R6385:Fanca UTSW 8 124,032,606 (GRCm39) splice site probably null
R6762:Fanca UTSW 8 123,998,042 (GRCm39) missense probably benign 0.26
R6795:Fanca UTSW 8 124,045,232 (GRCm39) missense probably benign 0.02
R6810:Fanca UTSW 8 124,013,216 (GRCm39) missense probably damaging 0.99
R7153:Fanca UTSW 8 124,043,164 (GRCm39) missense probably damaging 1.00
R7170:Fanca UTSW 8 123,997,945 (GRCm39) missense probably damaging 1.00
R7204:Fanca UTSW 8 124,013,216 (GRCm39) missense probably damaging 0.98
R7366:Fanca UTSW 8 124,007,952 (GRCm39) missense probably benign 0.08
R7599:Fanca UTSW 8 123,997,999 (GRCm39) missense probably benign
R7639:Fanca UTSW 8 124,018,134 (GRCm39) critical splice donor site probably null
R7650:Fanca UTSW 8 123,995,303 (GRCm39) splice site probably null
R8066:Fanca UTSW 8 124,030,679 (GRCm39) missense unknown
R8247:Fanca UTSW 8 124,010,694 (GRCm39) unclassified probably benign
R8312:Fanca UTSW 8 123,996,549 (GRCm39) intron probably benign
R8327:Fanca UTSW 8 124,039,984 (GRCm39) nonsense probably null
R8719:Fanca UTSW 8 124,014,867 (GRCm39) missense probably benign 0.00
R8826:Fanca UTSW 8 123,995,209 (GRCm39) missense probably benign 0.07
R8987:Fanca UTSW 8 124,024,538 (GRCm39) missense probably damaging 1.00
R9017:Fanca UTSW 8 124,035,307 (GRCm39) missense possibly damaging 0.69
R9319:Fanca UTSW 8 124,018,190 (GRCm39) missense probably benign
R9471:Fanca UTSW 8 124,000,897 (GRCm39) missense possibly damaging 0.88
R9542:Fanca UTSW 8 124,023,078 (GRCm39) missense probably damaging 0.98
R9656:Fanca UTSW 8 124,031,482 (GRCm39) missense probably benign 0.02
R9708:Fanca UTSW 8 124,001,263 (GRCm39) nonsense probably null
V7732:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
X0025:Fanca UTSW 8 124,003,287 (GRCm39) intron probably benign
X0062:Fanca UTSW 8 124,031,591 (GRCm39) missense possibly damaging 0.95
Z1177:Fanca UTSW 8 124,039,368 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACATGAGAGGTGCTCAAGCTCTG -3'
(R):5'- TCTGTTCCCAAGGTGGATGACGAG -3'

Sequencing Primer
(F):5'- GAGAGCGTTATCAGTCTGCTCC -3'
(R):5'- TGGATGACGAGGCCGAG -3'
Posted On 2013-04-11