Incidental Mutation 'R1823:Dock10'
ID 206538
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Name dedicator of cytokinesis 10
Synonyms Zizimin3, A630054M16Rik, Jr5, ZIZ3, Jr4, 9330153B10Rik
MMRRC Submission 039851-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.487) question?
Stock # R1823 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 80478790-80736244 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to A at 80520814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190595] [ENSMUST00000190983] [ENSMUST00000190983]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000077946
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077946
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187774
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187774
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190595
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190595
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190983
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190983
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 G A 11: 7,111,312 (GRCm39) V868I probably benign Het
Ahnak G T 19: 8,982,269 (GRCm39) M1184I probably damaging Het
Akap11 T C 14: 78,748,928 (GRCm39) E1153G probably damaging Het
Amy1 T C 3: 113,356,376 (GRCm39) N260S probably null Het
Ankrd6 A G 4: 32,824,427 (GRCm39) L129P probably damaging Het
Aox1 A T 1: 58,351,518 (GRCm39) T702S probably benign Het
Apobec1 G T 6: 122,555,845 (GRCm39) T204K possibly damaging Het
Arhgef19 A G 4: 140,976,457 (GRCm39) R433G probably benign Het
Atf6b T A 17: 34,867,618 (GRCm39) H110Q possibly damaging Het
Btnl4 C T 17: 34,694,826 (GRCm39) probably null Het
Camsap2 T C 1: 136,201,521 (GRCm39) T662A possibly damaging Het
Cbs G A 17: 31,843,245 (GRCm39) H229Y probably damaging Het
Cct8 G A 16: 87,287,442 (GRCm39) R111* probably null Het
Cdc42bpb C T 12: 111,293,993 (GRCm39) A250T probably damaging Het
Chrd A G 16: 20,560,097 (GRCm39) probably benign Het
Ckap2l A G 2: 129,117,499 (GRCm39) F559L probably damaging Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
D630003M21Rik T C 2: 158,059,477 (GRCm39) Y141C probably damaging Het
Dbf4 T C 5: 8,447,539 (GRCm39) N557S probably benign Het
Dct T G 14: 118,273,935 (GRCm39) N324T probably benign Het
Dip2a A T 10: 76,114,336 (GRCm39) L999* probably null Het
Dync2li1 A T 17: 84,957,225 (GRCm39) D330V probably damaging Het
Eif4g3 T A 4: 137,907,802 (GRCm39) D1267E probably benign Het
Enc1 A G 13: 97,382,486 (GRCm39) E332G possibly damaging Het
Fat2 C T 11: 55,147,606 (GRCm39) V3879I probably benign Het
Fh1 A T 1: 175,444,114 (GRCm39) I117K probably damaging Het
Fkbp15 A G 4: 62,255,328 (GRCm39) L227P probably damaging Het
Fpr1 T A 17: 18,097,315 (GRCm39) M225L probably benign Het
Fras1 A T 5: 96,918,547 (GRCm39) I3528F probably damaging Het
Grm7 A G 6: 111,184,730 (GRCm39) T354A probably benign Het
Ift27 T A 15: 78,057,978 (GRCm39) I9F possibly damaging Het
Igf1r A G 7: 67,844,729 (GRCm39) D834G possibly damaging Het
Igsf9b T A 9: 27,243,028 (GRCm39) L738Q probably damaging Het
Itgam A T 7: 127,663,904 (GRCm39) T44S probably benign Het
Ivd T A 2: 118,692,515 (GRCm39) I5N probably benign Het
Jcad T C 18: 4,675,780 (GRCm39) S1181P probably damaging Het
Kctd18 A G 1: 57,995,524 (GRCm39) V251A probably benign Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo18a T C 11: 77,715,923 (GRCm39) probably benign Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myocd C A 11: 65,069,496 (GRCm39) M909I probably benign Het
Ndufv3 G A 17: 31,750,219 (GRCm39) R467Q probably damaging Het
Nkpd1 G A 7: 19,257,177 (GRCm39) V319M probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or1af1 T C 2: 37,110,344 (GRCm39) V281A probably damaging Het
Or1p1c C T 11: 74,161,043 (GRCm39) A276V probably damaging Het
Or2q1 G T 6: 42,795,202 (GRCm39) A266S possibly damaging Het
Or2t1 T A 14: 14,328,774 (GRCm38) L221Q probably damaging Het
Or4c111 A G 2: 88,843,722 (GRCm39) S229P probably benign Het
Or5b101 C A 19: 13,005,181 (GRCm39) V171L probably benign Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pcdhb9 A G 18: 37,535,871 (GRCm39) T622A probably benign Het
Pdpk1 A T 17: 24,317,150 (GRCm39) probably benign Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 G T 10: 3,853,658 (GRCm39) probably null Het
Plekhh2 A G 17: 84,882,617 (GRCm39) Y708C probably damaging Het
Pnp T C 14: 51,187,786 (GRCm39) F107L probably damaging Het
Postn T A 3: 54,292,708 (GRCm39) probably null Het
Prcp A T 7: 92,577,883 (GRCm39) D349V probably damaging Het
Prl3a1 A T 13: 27,454,177 (GRCm39) I52F probably damaging Het
Pym1 G A 10: 128,601,913 (GRCm39) probably benign Het
Rad9a A T 19: 4,247,241 (GRCm39) I248N probably damaging Het
Ror2 T G 13: 53,264,341 (GRCm39) E917A probably benign Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sema6d A G 2: 124,501,476 (GRCm39) probably null Het
Shisal1 T C 15: 84,290,669 (GRCm39) T213A probably benign Het
Slc4a2 C T 5: 24,632,618 (GRCm39) A12V probably damaging Het
Slco6b1 T G 1: 96,888,901 (GRCm39) noncoding transcript Het
Slf2 A T 19: 44,923,687 (GRCm39) H167L possibly damaging Het
Snx9 G T 17: 5,970,946 (GRCm39) G429V probably damaging Het
Sod3 G T 5: 52,525,504 (GRCm39) V68L probably benign Het
Spta1 T A 1: 174,074,115 (GRCm39) D2351E probably benign Het
Srpk3 G A X: 72,821,561 (GRCm39) R425Q possibly damaging Het
Tatdn1 C T 15: 58,788,005 (GRCm39) G171E probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Tnfsf9 A G 17: 57,412,738 (GRCm39) T103A probably benign Het
Tpm3-rs7 T C 14: 113,552,595 (GRCm39) L163P possibly damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Ucp1 C T 8: 84,020,661 (GRCm39) T157I probably damaging Het
Uspl1 T A 5: 149,151,224 (GRCm39) L794Q probably benign Het
Vmn1r5 T A 6: 56,962,580 (GRCm39) V85E probably damaging Het
Vmn1r58 A G 7: 5,413,405 (GRCm39) I275T possibly damaging Het
Vmn2r79 A G 7: 86,687,080 (GRCm39) I820M probably damaging Het
Wscd1 C A 11: 71,651,044 (GRCm39) P124T probably benign Het
Zfp780b A T 7: 27,662,525 (GRCm39) C677S possibly damaging Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80,562,729 (GRCm39) missense probably damaging 1.00
IGL00783:Dock10 APN 1 80,550,166 (GRCm39) splice site probably benign
IGL00784:Dock10 APN 1 80,550,166 (GRCm39) splice site probably benign
IGL00858:Dock10 APN 1 80,545,720 (GRCm39) missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80,508,962 (GRCm39) missense probably damaging 1.00
IGL01351:Dock10 APN 1 80,570,876 (GRCm39) missense probably damaging 1.00
IGL01356:Dock10 APN 1 80,501,459 (GRCm39) missense probably damaging 1.00
IGL01584:Dock10 APN 1 80,511,567 (GRCm39) missense probably damaging 0.99
IGL01619:Dock10 APN 1 80,612,015 (GRCm39) splice site probably benign
IGL01678:Dock10 APN 1 80,521,069 (GRCm39) missense probably damaging 1.00
IGL01759:Dock10 APN 1 80,503,990 (GRCm39) missense probably damaging 1.00
IGL02238:Dock10 APN 1 80,511,510 (GRCm39) missense probably damaging 0.99
IGL02352:Dock10 APN 1 80,483,378 (GRCm39) missense probably damaging 1.00
IGL02359:Dock10 APN 1 80,483,378 (GRCm39) missense probably damaging 1.00
IGL02377:Dock10 APN 1 80,562,711 (GRCm39) critical splice donor site probably null
IGL02433:Dock10 APN 1 80,507,905 (GRCm39) missense probably damaging 1.00
IGL02471:Dock10 APN 1 80,493,339 (GRCm39) missense probably damaging 0.99
IGL02645:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02646:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02648:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02649:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02650:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02652:Dock10 APN 1 80,570,561 (GRCm39) splice site probably null
IGL02718:Dock10 APN 1 80,501,535 (GRCm39) missense probably benign 0.00
IGL02998:Dock10 APN 1 80,551,259 (GRCm39) missense probably damaging 1.00
IGL03057:Dock10 APN 1 80,545,088 (GRCm39) missense probably damaging 1.00
IGL03066:Dock10 APN 1 80,562,758 (GRCm39) missense probably benign 0.00
IGL03106:Dock10 APN 1 80,546,551 (GRCm39) missense probably damaging 0.98
IGL03148:Dock10 APN 1 80,518,075 (GRCm39) missense probably benign 0.01
IGL03271:Dock10 APN 1 80,483,126 (GRCm39) missense probably damaging 1.00
IGL03352:Dock10 APN 1 80,584,013 (GRCm39) splice site probably benign
LCD18:Dock10 UTSW 1 80,716,623 (GRCm38) intron probably benign
PIT4366001:Dock10 UTSW 1 80,573,438 (GRCm39) missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80,483,163 (GRCm39) missense probably damaging 1.00
R0019:Dock10 UTSW 1 80,583,642 (GRCm39) missense probably damaging 1.00
R0081:Dock10 UTSW 1 80,584,295 (GRCm39) missense probably damaging 0.99
R0095:Dock10 UTSW 1 80,501,788 (GRCm39) missense probably benign 0.00
R0241:Dock10 UTSW 1 80,556,340 (GRCm39) missense probably benign
R0241:Dock10 UTSW 1 80,556,340 (GRCm39) missense probably benign
R0255:Dock10 UTSW 1 80,583,593 (GRCm39) missense probably damaging 1.00
R0267:Dock10 UTSW 1 80,490,171 (GRCm39) missense probably damaging 1.00
R0299:Dock10 UTSW 1 80,514,646 (GRCm39) missense probably damaging 0.99
R0365:Dock10 UTSW 1 80,573,400 (GRCm39) missense probably damaging 1.00
R0387:Dock10 UTSW 1 80,517,993 (GRCm39) missense probably damaging 1.00
R0403:Dock10 UTSW 1 80,501,787 (GRCm39) missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80,518,193 (GRCm39) missense probably benign 0.03
R0414:Dock10 UTSW 1 80,513,650 (GRCm39) missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80,518,936 (GRCm39) splice site probably benign
R0698:Dock10 UTSW 1 80,507,895 (GRCm39) missense probably damaging 1.00
R0711:Dock10 UTSW 1 80,501,692 (GRCm39) missense probably damaging 1.00
R0925:Dock10 UTSW 1 80,514,657 (GRCm39) missense probably benign 0.20
R1162:Dock10 UTSW 1 80,546,559 (GRCm39) missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80,518,060 (GRCm39) missense probably damaging 1.00
R1440:Dock10 UTSW 1 80,526,853 (GRCm39) missense probably benign 0.03
R1469:Dock10 UTSW 1 80,490,275 (GRCm39) missense probably benign 0.05
R1469:Dock10 UTSW 1 80,490,275 (GRCm39) missense probably benign 0.05
R1525:Dock10 UTSW 1 80,583,881 (GRCm39) critical splice donor site probably null
R1544:Dock10 UTSW 1 80,570,352 (GRCm39) missense probably benign 0.00
R1601:Dock10 UTSW 1 80,527,519 (GRCm39) missense probably benign 0.00
R1757:Dock10 UTSW 1 80,511,586 (GRCm39) missense probably damaging 1.00
R1765:Dock10 UTSW 1 80,583,540 (GRCm39) missense probably damaging 1.00
R1783:Dock10 UTSW 1 80,551,897 (GRCm39) missense probably benign 0.17
R1827:Dock10 UTSW 1 80,508,009 (GRCm39) missense probably benign 0.07
R1844:Dock10 UTSW 1 80,520,918 (GRCm39) missense probably damaging 0.99
R1856:Dock10 UTSW 1 80,584,285 (GRCm39) missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80,488,143 (GRCm39) missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80,527,506 (GRCm39) missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80,483,360 (GRCm39) missense probably damaging 0.99
R2112:Dock10 UTSW 1 80,483,359 (GRCm39) missense probably damaging 1.00
R2113:Dock10 UTSW 1 80,584,280 (GRCm39) missense probably damaging 1.00
R2439:Dock10 UTSW 1 80,510,149 (GRCm39) missense probably damaging 1.00
R2566:Dock10 UTSW 1 80,517,970 (GRCm39) missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80,510,074 (GRCm39) missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80,514,643 (GRCm39) missense probably damaging 0.99
R3768:Dock10 UTSW 1 80,510,085 (GRCm39) missense probably damaging 1.00
R4009:Dock10 UTSW 1 80,510,148 (GRCm39) missense probably damaging 1.00
R4016:Dock10 UTSW 1 80,584,286 (GRCm39) missense probably damaging 1.00
R4179:Dock10 UTSW 1 80,488,134 (GRCm39) missense probably benign 0.00
R4243:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4244:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4245:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4674:Dock10 UTSW 1 80,584,337 (GRCm39) missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80,493,330 (GRCm39) missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80,518,998 (GRCm39) missense probably damaging 1.00
R4851:Dock10 UTSW 1 80,526,874 (GRCm39) missense probably benign 0.33
R4911:Dock10 UTSW 1 80,583,953 (GRCm39) missense probably damaging 1.00
R4976:Dock10 UTSW 1 80,545,711 (GRCm39) critical splice donor site probably null
R5086:Dock10 UTSW 1 80,529,189 (GRCm39) missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80,545,711 (GRCm39) critical splice donor site probably null
R5301:Dock10 UTSW 1 80,625,973 (GRCm39) missense probably benign 0.41
R5404:Dock10 UTSW 1 80,481,630 (GRCm39) intron probably benign
R5457:Dock10 UTSW 1 80,501,781 (GRCm39) missense probably damaging 1.00
R5790:Dock10 UTSW 1 80,482,887 (GRCm39) missense probably benign 0.00
R5845:Dock10 UTSW 1 80,483,459 (GRCm39) intron probably benign
R5871:Dock10 UTSW 1 80,519,057 (GRCm39) critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80,551,855 (GRCm39) missense probably damaging 1.00
R5881:Dock10 UTSW 1 80,538,640 (GRCm39) missense probably benign 0.19
R5895:Dock10 UTSW 1 80,514,676 (GRCm39) missense probably benign
R5935:Dock10 UTSW 1 80,483,304 (GRCm39) intron probably benign
R5965:Dock10 UTSW 1 80,546,461 (GRCm39) splice site probably null
R5966:Dock10 UTSW 1 80,546,225 (GRCm39) missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80,583,890 (GRCm39) missense probably damaging 0.98
R6029:Dock10 UTSW 1 80,514,663 (GRCm39) missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80,510,148 (GRCm39) missense probably damaging 1.00
R6145:Dock10 UTSW 1 80,553,621 (GRCm39) nonsense probably null
R6257:Dock10 UTSW 1 80,481,413 (GRCm39) intron probably benign
R6274:Dock10 UTSW 1 80,516,540 (GRCm39) missense probably damaging 1.00
R6324:Dock10 UTSW 1 80,482,893 (GRCm39) missense probably benign 0.03
R6346:Dock10 UTSW 1 80,553,573 (GRCm39) splice site probably null
R6476:Dock10 UTSW 1 80,518,959 (GRCm39) nonsense probably null
R6516:Dock10 UTSW 1 80,518,178 (GRCm39) missense probably damaging 1.00
R6526:Dock10 UTSW 1 80,564,068 (GRCm39) missense probably damaging 0.97
R6534:Dock10 UTSW 1 80,481,388 (GRCm39) missense probably benign 0.01
R6620:Dock10 UTSW 1 80,570,355 (GRCm39) missense probably benign 0.01
R6640:Dock10 UTSW 1 80,511,555 (GRCm39) nonsense probably null
R6669:Dock10 UTSW 1 80,570,572 (GRCm39) missense probably damaging 1.00
R6672:Dock10 UTSW 1 80,490,248 (GRCm39) missense probably benign 0.00
R6679:Dock10 UTSW 1 80,544,514 (GRCm39) missense probably benign 0.11
R6682:Dock10 UTSW 1 80,490,338 (GRCm39) missense probably damaging 1.00
R6712:Dock10 UTSW 1 80,514,583 (GRCm39) missense probably benign 0.00
R6726:Dock10 UTSW 1 80,490,147 (GRCm39) missense probably damaging 1.00
R6788:Dock10 UTSW 1 80,508,962 (GRCm39) missense probably damaging 1.00
R6805:Dock10 UTSW 1 80,564,407 (GRCm39) missense probably benign
R6815:Dock10 UTSW 1 80,516,576 (GRCm39) missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80,593,082 (GRCm39) missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80,508,976 (GRCm39) missense probably damaging 1.00
R6964:Dock10 UTSW 1 80,481,365 (GRCm39) intron probably benign
R7026:Dock10 UTSW 1 80,479,504 (GRCm39) missense probably benign 0.40
R7084:Dock10 UTSW 1 80,481,573 (GRCm39) missense
R7087:Dock10 UTSW 1 80,570,543 (GRCm39) missense probably benign
R7158:Dock10 UTSW 1 80,564,589 (GRCm39) critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80,518,048 (GRCm39) missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80,546,246 (GRCm39) missense probably benign 0.01
R7255:Dock10 UTSW 1 80,520,816 (GRCm39) critical splice donor site probably null
R7320:Dock10 UTSW 1 80,527,421 (GRCm39) critical splice donor site probably null
R7359:Dock10 UTSW 1 80,687,065 (GRCm39) missense probably benign 0.01
R7423:Dock10 UTSW 1 80,501,497 (GRCm39) missense possibly damaging 0.67
R7464:Dock10 UTSW 1 80,518,032 (GRCm39) missense probably damaging 0.99
R7483:Dock10 UTSW 1 80,493,283 (GRCm39) missense probably benign 0.01
R7487:Dock10 UTSW 1 80,562,765 (GRCm39) missense probably benign 0.00
R7789:Dock10 UTSW 1 80,536,930 (GRCm39) missense possibly damaging 0.82
R7943:Dock10 UTSW 1 80,626,006 (GRCm39) missense probably damaging 0.98
R7962:Dock10 UTSW 1 80,564,085 (GRCm39) missense possibly damaging 0.88
R8079:Dock10 UTSW 1 80,556,421 (GRCm39) missense probably benign 0.00
R8086:Dock10 UTSW 1 80,481,707 (GRCm39) missense probably benign 0.17
R8184:Dock10 UTSW 1 80,530,469 (GRCm39) missense probably damaging 1.00
R8220:Dock10 UTSW 1 80,506,366 (GRCm39) missense probably null 1.00
R8225:Dock10 UTSW 1 80,481,447 (GRCm39) nonsense probably null
R8267:Dock10 UTSW 1 80,518,045 (GRCm39) missense probably benign 0.00
R8276:Dock10 UTSW 1 80,505,998 (GRCm39) missense probably benign
R8294:Dock10 UTSW 1 80,488,079 (GRCm39) missense possibly damaging 0.88
R8298:Dock10 UTSW 1 80,514,654 (GRCm39) missense probably benign 0.00
R8326:Dock10 UTSW 1 80,583,892 (GRCm39) missense possibly damaging 0.77
R8724:Dock10 UTSW 1 80,570,344 (GRCm39) missense probably benign 0.00
R8828:Dock10 UTSW 1 80,521,134 (GRCm39) missense probably damaging 1.00
R8846:Dock10 UTSW 1 80,545,786 (GRCm39) missense possibly damaging 0.93
R8919:Dock10 UTSW 1 80,483,147 (GRCm39) missense probably benign 0.00
R8950:Dock10 UTSW 1 80,519,016 (GRCm39) missense probably benign
R8993:Dock10 UTSW 1 80,551,888 (GRCm39) missense probably benign 0.21
R9028:Dock10 UTSW 1 80,584,012 (GRCm39) splice site probably benign
R9115:Dock10 UTSW 1 80,490,156 (GRCm39) missense probably damaging 1.00
R9327:Dock10 UTSW 1 80,510,184 (GRCm39) missense probably damaging 1.00
R9342:Dock10 UTSW 1 80,570,360 (GRCm39) missense probably benign
R9421:Dock10 UTSW 1 80,501,509 (GRCm39) missense probably damaging 1.00
R9431:Dock10 UTSW 1 80,583,593 (GRCm39) missense probably damaging 1.00
R9486:Dock10 UTSW 1 80,479,452 (GRCm39) missense unknown
R9521:Dock10 UTSW 1 80,501,763 (GRCm39) missense probably damaging 1.00
R9598:Dock10 UTSW 1 80,625,939 (GRCm39) missense probably benign 0.15
R9629:Dock10 UTSW 1 80,481,389 (GRCm39) missense
R9703:Dock10 UTSW 1 80,517,540 (GRCm39) missense probably damaging 0.98
RF021:Dock10 UTSW 1 80,542,290 (GRCm39) critical splice acceptor site probably null
X0025:Dock10 UTSW 1 80,514,637 (GRCm39) missense probably damaging 0.98
X0065:Dock10 UTSW 1 80,518,977 (GRCm39) missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80,510,064 (GRCm39) missense probably damaging 1.00
Z1176:Dock10 UTSW 1 80,538,671 (GRCm39) missense probably benign
Z1177:Dock10 UTSW 1 80,536,917 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGTGCAGATGTGAAGAGTGC -3'
(R):5'- CTGAGCCTATTGATTTTCACGTG -3'

Sequencing Primer
(F):5'- TTCCAAAGAGAGGGACGGGC -3'
(R):5'- ACGTGAATCATTTCTCTTGTCTG -3'
Posted On 2014-06-23