Incidental Mutation 'R1823:Fh1'
ID 206542
Institutional Source Beutler Lab
Gene Symbol Fh1
Ensembl Gene ENSMUSG00000026526
Gene Name fumarate hydratase 1
Synonyms fumarase
MMRRC Submission 039851-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1823 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 175428944-175453201 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 175444114 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 117 (I117K)
Ref Sequence ENSEMBL: ENSMUSP00000027810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027810] [ENSMUST00000140474] [ENSMUST00000154956]
AlphaFold P97807
Predicted Effect probably damaging
Transcript: ENSMUST00000027810
AA Change: I117K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027810
Gene: ENSMUSG00000026526
AA Change: I117K

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:Lyase_1 55 386 1.8e-124 PFAM
Pfam:FumaraseC_C 452 505 2.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140474
SMART Domains Protein: ENSMUSP00000122943
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 44 240 2.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154956
SMART Domains Protein: ENSMUSP00000135140
Gene: ENSMUSG00000026526

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Meta Mutation Damage Score 0.9750 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele fail to develop past the egg-cylinder stage and die at E6.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 G A 11: 7,111,312 (GRCm39) V868I probably benign Het
Ahnak G T 19: 8,982,269 (GRCm39) M1184I probably damaging Het
Akap11 T C 14: 78,748,928 (GRCm39) E1153G probably damaging Het
Amy1 T C 3: 113,356,376 (GRCm39) N260S probably null Het
Ankrd6 A G 4: 32,824,427 (GRCm39) L129P probably damaging Het
Aox1 A T 1: 58,351,518 (GRCm39) T702S probably benign Het
Apobec1 G T 6: 122,555,845 (GRCm39) T204K possibly damaging Het
Arhgef19 A G 4: 140,976,457 (GRCm39) R433G probably benign Het
Atf6b T A 17: 34,867,618 (GRCm39) H110Q possibly damaging Het
Btnl4 C T 17: 34,694,826 (GRCm39) probably null Het
Camsap2 T C 1: 136,201,521 (GRCm39) T662A possibly damaging Het
Cbs G A 17: 31,843,245 (GRCm39) H229Y probably damaging Het
Cct8 G A 16: 87,287,442 (GRCm39) R111* probably null Het
Cdc42bpb C T 12: 111,293,993 (GRCm39) A250T probably damaging Het
Chrd A G 16: 20,560,097 (GRCm39) probably benign Het
Ckap2l A G 2: 129,117,499 (GRCm39) F559L probably damaging Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
D630003M21Rik T C 2: 158,059,477 (GRCm39) Y141C probably damaging Het
Dbf4 T C 5: 8,447,539 (GRCm39) N557S probably benign Het
Dct T G 14: 118,273,935 (GRCm39) N324T probably benign Het
Dip2a A T 10: 76,114,336 (GRCm39) L999* probably null Het
Dock10 T A 1: 80,520,814 (GRCm39) probably null Het
Dync2li1 A T 17: 84,957,225 (GRCm39) D330V probably damaging Het
Eif4g3 T A 4: 137,907,802 (GRCm39) D1267E probably benign Het
Enc1 A G 13: 97,382,486 (GRCm39) E332G possibly damaging Het
Fat2 C T 11: 55,147,606 (GRCm39) V3879I probably benign Het
Fkbp15 A G 4: 62,255,328 (GRCm39) L227P probably damaging Het
Fpr1 T A 17: 18,097,315 (GRCm39) M225L probably benign Het
Fras1 A T 5: 96,918,547 (GRCm39) I3528F probably damaging Het
Grm7 A G 6: 111,184,730 (GRCm39) T354A probably benign Het
Ift27 T A 15: 78,057,978 (GRCm39) I9F possibly damaging Het
Igf1r A G 7: 67,844,729 (GRCm39) D834G possibly damaging Het
Igsf9b T A 9: 27,243,028 (GRCm39) L738Q probably damaging Het
Itgam A T 7: 127,663,904 (GRCm39) T44S probably benign Het
Ivd T A 2: 118,692,515 (GRCm39) I5N probably benign Het
Jcad T C 18: 4,675,780 (GRCm39) S1181P probably damaging Het
Kctd18 A G 1: 57,995,524 (GRCm39) V251A probably benign Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo18a T C 11: 77,715,923 (GRCm39) probably benign Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myocd C A 11: 65,069,496 (GRCm39) M909I probably benign Het
Ndufv3 G A 17: 31,750,219 (GRCm39) R467Q probably damaging Het
Nkpd1 G A 7: 19,257,177 (GRCm39) V319M probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or1af1 T C 2: 37,110,344 (GRCm39) V281A probably damaging Het
Or1p1c C T 11: 74,161,043 (GRCm39) A276V probably damaging Het
Or2q1 G T 6: 42,795,202 (GRCm39) A266S possibly damaging Het
Or2t1 T A 14: 14,328,774 (GRCm38) L221Q probably damaging Het
Or4c111 A G 2: 88,843,722 (GRCm39) S229P probably benign Het
Or5b101 C A 19: 13,005,181 (GRCm39) V171L probably benign Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pcdhb9 A G 18: 37,535,871 (GRCm39) T622A probably benign Het
Pdpk1 A T 17: 24,317,150 (GRCm39) probably benign Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 G T 10: 3,853,658 (GRCm39) probably null Het
Plekhh2 A G 17: 84,882,617 (GRCm39) Y708C probably damaging Het
Pnp T C 14: 51,187,786 (GRCm39) F107L probably damaging Het
Postn T A 3: 54,292,708 (GRCm39) probably null Het
Prcp A T 7: 92,577,883 (GRCm39) D349V probably damaging Het
Prl3a1 A T 13: 27,454,177 (GRCm39) I52F probably damaging Het
Pym1 G A 10: 128,601,913 (GRCm39) probably benign Het
Rad9a A T 19: 4,247,241 (GRCm39) I248N probably damaging Het
Ror2 T G 13: 53,264,341 (GRCm39) E917A probably benign Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sema6d A G 2: 124,501,476 (GRCm39) probably null Het
Shisal1 T C 15: 84,290,669 (GRCm39) T213A probably benign Het
Slc4a2 C T 5: 24,632,618 (GRCm39) A12V probably damaging Het
Slco6b1 T G 1: 96,888,901 (GRCm39) noncoding transcript Het
Slf2 A T 19: 44,923,687 (GRCm39) H167L possibly damaging Het
Snx9 G T 17: 5,970,946 (GRCm39) G429V probably damaging Het
Sod3 G T 5: 52,525,504 (GRCm39) V68L probably benign Het
Spta1 T A 1: 174,074,115 (GRCm39) D2351E probably benign Het
Srpk3 G A X: 72,821,561 (GRCm39) R425Q possibly damaging Het
Tatdn1 C T 15: 58,788,005 (GRCm39) G171E probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Tnfsf9 A G 17: 57,412,738 (GRCm39) T103A probably benign Het
Tpm3-rs7 T C 14: 113,552,595 (GRCm39) L163P possibly damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Ucp1 C T 8: 84,020,661 (GRCm39) T157I probably damaging Het
Uspl1 T A 5: 149,151,224 (GRCm39) L794Q probably benign Het
Vmn1r5 T A 6: 56,962,580 (GRCm39) V85E probably damaging Het
Vmn1r58 A G 7: 5,413,405 (GRCm39) I275T possibly damaging Het
Vmn2r79 A G 7: 86,687,080 (GRCm39) I820M probably damaging Het
Wscd1 C A 11: 71,651,044 (GRCm39) P124T probably benign Het
Zfp780b A T 7: 27,662,525 (GRCm39) C677S possibly damaging Het
Other mutations in Fh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Fh1 APN 1 175,429,108 (GRCm39) missense probably damaging 1.00
IGL02637:Fh1 APN 1 175,437,332 (GRCm39) missense probably benign 0.00
IGL02954:Fh1 APN 1 175,437,301 (GRCm39) missense probably damaging 1.00
IGL03056:Fh1 APN 1 175,433,728 (GRCm39) missense probably damaging 1.00
IGL03309:Fh1 APN 1 175,431,609 (GRCm39) missense probably benign 0.01
R0729:Fh1 UTSW 1 175,442,383 (GRCm39) missense probably damaging 1.00
R1240:Fh1 UTSW 1 175,431,581 (GRCm39) missense probably damaging 1.00
R1327:Fh1 UTSW 1 175,437,310 (GRCm39) missense probably benign 0.32
R1576:Fh1 UTSW 1 175,435,385 (GRCm39) missense probably null 1.00
R1779:Fh1 UTSW 1 175,428,990 (GRCm39) makesense probably null
R1851:Fh1 UTSW 1 175,435,452 (GRCm39) missense probably damaging 1.00
R1943:Fh1 UTSW 1 175,437,344 (GRCm39) missense probably benign
R2163:Fh1 UTSW 1 175,442,406 (GRCm39) missense possibly damaging 0.80
R3766:Fh1 UTSW 1 175,442,316 (GRCm39) missense probably damaging 1.00
R4193:Fh1 UTSW 1 175,442,407 (GRCm39) missense possibly damaging 0.51
R4672:Fh1 UTSW 1 175,431,617 (GRCm39) missense probably benign 0.07
R4812:Fh1 UTSW 1 175,429,025 (GRCm39) missense probably damaging 0.99
R4849:Fh1 UTSW 1 175,448,072 (GRCm39) missense probably benign 0.00
R4905:Fh1 UTSW 1 175,446,639 (GRCm39) missense probably damaging 1.00
R4978:Fh1 UTSW 1 175,431,533 (GRCm39) missense probably damaging 1.00
R6645:Fh1 UTSW 1 175,442,442 (GRCm39) missense possibly damaging 0.94
R6681:Fh1 UTSW 1 175,446,690 (GRCm39) missense probably null 0.71
R7075:Fh1 UTSW 1 175,435,421 (GRCm39) missense probably benign 0.00
R7646:Fh1 UTSW 1 175,442,479 (GRCm39) missense probably benign 0.03
R7783:Fh1 UTSW 1 175,439,744 (GRCm39) missense probably damaging 1.00
R7862:Fh1 UTSW 1 175,442,400 (GRCm39) missense probably damaging 0.97
R7991:Fh1 UTSW 1 175,437,337 (GRCm39) missense probably damaging 1.00
R8694:Fh1 UTSW 1 175,448,126 (GRCm39) missense probably benign 0.00
R8765:Fh1 UTSW 1 175,435,378 (GRCm39) intron probably benign
R8882:Fh1 UTSW 1 175,437,353 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCAAGATGTTTCGAGCACTG -3'
(R):5'- ACACAGAAGCAAGTTTTCTCTG -3'

Sequencing Primer
(F):5'- GTTTCGAGCACTGAGTAATAACG -3'
(R):5'- AGAACCTTGGTACCATTTTTGC -3'
Posted On 2014-06-23