Mutagenetix > Incidental Mutation

Incidental Mutation 'R1823:Myo3a'

206544

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

039851-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1823 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22340280 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 509 (Y509F)

Ref Sequence

ENSEMBL: ENSMUSP00000120573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000044749
AA Change: Y517F

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: Y517F

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000153002
AA Change: Y509F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: Y509F

Domain	Start	End	E-Value	Type
S_TKc	21	287	1.62e-91	SMART
MYSc	332	753	3.06e-35	SMART

Meta Mutation Damage Score

0.4083

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.6%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	T	C	15: 84,406,468	T213A	probably benign	Het
Adcy1	G	A	11: 7,161,312	V868I	probably benign	Het
Ahnak	G	T	19: 9,004,905	M1184I	probably damaging	Het
Akap11	T	C	14: 78,511,488	E1153G	probably damaging	Het
Amy1	T	C	3: 113,562,727	N260S	probably null	Het
Ankrd6	A	G	4: 32,824,427	L129P	probably damaging	Het
Aox2	A	T	1: 58,312,359	T702S	probably benign	Het
Apobec1	G	T	6: 122,578,886	T204K	possibly damaging	Het
Arhgef19	A	G	4: 141,249,146	R433G	probably benign	Het
Atf6b	T	A	17: 34,648,644	H110Q	possibly damaging	Het
Btnl4	C	T	17: 34,475,852		probably null	Het
Camsap2	T	C	1: 136,273,783	T662A	possibly damaging	Het
Cbs	G	A	17: 31,624,271	H229Y	probably damaging	Het
Cct8	G	A	16: 87,490,554	R111*	probably null	Het
Cdc42bpb	C	T	12: 111,327,559	A250T	probably damaging	Het
Chrd	A	G	16: 20,741,347		probably benign	Het
Ckap2l	A	G	2: 129,275,579	F559L	probably damaging	Het
D630003M21Rik	T	C	2: 158,217,557	Y141C	probably damaging	Het
Dbf4	T	C	5: 8,397,539	N557S	probably benign	Het
Dct	T	G	14: 118,036,523	N324T	probably benign	Het
Dip2a	A	T	10: 76,278,502	L999*	probably null	Het
Dock10	T	A	1: 80,543,097		probably null	Het
Dync2li1	A	T	17: 84,649,797	D330V	probably damaging	Het
Eif4g3	T	A	4: 138,180,491	D1267E	probably benign	Het
Enc1	A	G	13: 97,245,978	E332G	possibly damaging	Het
Fat2	C	T	11: 55,256,780	V3879I	probably benign	Het
Fh1	A	T	1: 175,616,548	I117K	probably damaging	Het
Fkbp15	A	G	4: 62,337,091	L227P	probably damaging	Het
Fpr1	T	A	17: 17,877,053	M225L	probably benign	Het
Fras1	A	T	5: 96,770,688	I3528F	probably damaging	Het
Grm7	A	G	6: 111,207,769	T354A	probably benign	Het
Ift27	T	A	15: 78,173,778	I9F	possibly damaging	Het
Igf1r	A	G	7: 68,194,981	D834G	possibly damaging	Het
Igsf9b	T	A	9: 27,331,732	L738Q	probably damaging	Het
Itgam	A	T	7: 128,064,732	T44S	probably benign	Het
Ivd	T	A	2: 118,862,034	I5N	probably benign	Het
Jcad	T	C	18: 4,675,780	S1181P	probably damaging	Het
Kctd18	A	G	1: 57,956,365	V251A	probably benign	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo18a	T	C	11: 77,825,097		probably benign	Het
Myocd	C	A	11: 65,178,670	M909I	probably benign	Het
Ndufv3	G	A	17: 31,531,245	R467Q	probably damaging	Het
Nkpd1	G	A	7: 19,523,252	V319M	probably damaging	Het
Olfr1216	A	G	2: 89,013,378	S229P	probably benign	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Olfr1453	C	A	19: 13,027,817	V171L	probably benign	Het
Olfr31	T	A	14: 14,328,774	L221Q	probably damaging	Het
Olfr366	T	C	2: 37,220,332	V281A	probably damaging	Het
Olfr406	C	T	11: 74,270,217	A276V	probably damaging	Het
Olfr450	G	T	6: 42,818,268	A266S	possibly damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pcdhb9	A	G	18: 37,402,818	T622A	probably benign	Het
Pdpk1	A	T	17: 24,098,176		probably benign	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	G	T	10: 3,903,658		probably null	Het
Plekhh2	A	G	17: 84,575,189	Y708C	probably damaging	Het
Pnp	T	C	14: 50,950,329	F107L	probably damaging	Het
Postn	T	A	3: 54,385,287		probably null	Het
Prcp	A	T	7: 92,928,675	D349V	probably damaging	Het
Prl3a1	A	T	13: 27,270,194	I52F	probably damaging	Het
Pym1	G	A	10: 128,766,044		probably benign	Het
Rad9a	A	T	19: 4,197,242	I248N	probably damaging	Het
Ror2	T	G	13: 53,110,305	E917A	probably benign	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sema6d	A	G	2: 124,659,556		probably null	Het
Slc4a2	C	T	5: 24,427,620	A12V	probably damaging	Het
Slco6b1	T	G	1: 96,961,176		noncoding transcript	Het
Slf2	A	T	19: 44,935,248	H167L	possibly damaging	Het
Snx9	G	T	17: 5,920,671	G429V	probably damaging	Het
Sod3	G	T	5: 52,368,162	V68L	probably benign	Het
Spta1	T	A	1: 174,246,549	D2351E	probably benign	Het
Srpk3	G	A	X: 73,777,955	R425Q	possibly damaging	Het
Tatdn1	C	T	15: 58,916,156	G171E	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnfsf9	A	G	17: 57,105,738	T103A	probably benign	Het
Tpm3-rs7	T	C	14: 113,315,163	L163P	possibly damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Ucp1	C	T	8: 83,294,032	T157I	probably damaging	Het
Uspl1	T	A	5: 149,214,414	L794Q	probably benign	Het
Vmn1r5	T	A	6: 56,985,595	V85E	probably damaging	Het
Vmn1r58	A	G	7: 5,410,406	I275T	possibly damaging	Het
Vmn2r79	A	G	7: 87,037,872	I820M	probably damaging	Het
Wscd1	C	A	11: 71,760,218	P124T	probably benign	Het
Zfp780b	A	T	7: 27,963,100	C677S	possibly damaging	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
R9464:Myo3a	UTSW	2	22227572	start gained	probably benign
R9487:Myo3a	UTSW	2	22241051	missense	probably benign
R9719:Myo3a	UTSW	2	22544455	missense	probably benign	0.02
R9799:Myo3a	UTSW	2	22600169	missense	probably damaging	1.00
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- ATGTAGGCTAATAACAGAACCCTG -3'
(R):5'- GAGCTTTTAACTCTATAAGCCTTGCTC -3'

Sequencing Primer
(F):5'- GAACCCTGCAAGAGAAGATTTTAC -3'
(R):5'- AAGGACCCAGATATAGCTCTCTCTTG -3'

Posted On

2014-06-23