Incidental Mutation 'R1823:Postn'
ID206551
Institutional Source Beutler Lab
Gene Symbol Postn
Ensembl Gene ENSMUSG00000027750
Gene Nameperiostin, osteoblast specific factor
Synonymsperi, A630052E07Rik, OSF-2, Osf2, Periostin
MMRRC Submission 039851-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1823 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54361109-54391037 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 54385287 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]
Predicted Effect probably null
Transcript: ENSMUST00000073012
SMART Domains Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081564
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081564
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107985
SMART Domains Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117373
SMART Domains Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127452
Predicted Effect probably benign
Transcript: ENSMUST00000143258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154157
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T C 15: 84,406,468 T213A probably benign Het
Adcy1 G A 11: 7,161,312 V868I probably benign Het
Ahnak G T 19: 9,004,905 M1184I probably damaging Het
Akap11 T C 14: 78,511,488 E1153G probably damaging Het
Amy1 T C 3: 113,562,727 N260S probably null Het
Ankrd6 A G 4: 32,824,427 L129P probably damaging Het
Aox2 A T 1: 58,312,359 T702S probably benign Het
Apobec1 G T 6: 122,578,886 T204K possibly damaging Het
Arhgef19 A G 4: 141,249,146 R433G probably benign Het
Atf6b T A 17: 34,648,644 H110Q possibly damaging Het
Btnl4 C T 17: 34,475,852 probably null Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cbs G A 17: 31,624,271 H229Y probably damaging Het
Cct8 G A 16: 87,490,554 R111* probably null Het
Cdc42bpb C T 12: 111,327,559 A250T probably damaging Het
Chrd A G 16: 20,741,347 probably benign Het
Ckap2l A G 2: 129,275,579 F559L probably damaging Het
D630003M21Rik T C 2: 158,217,557 Y141C probably damaging Het
Dbf4 T C 5: 8,397,539 N557S probably benign Het
Dct T G 14: 118,036,523 N324T probably benign Het
Dip2a A T 10: 76,278,502 L999* probably null Het
Dock10 T A 1: 80,543,097 probably null Het
Dync2li1 A T 17: 84,649,797 D330V probably damaging Het
Eif4g3 T A 4: 138,180,491 D1267E probably benign Het
Enc1 A G 13: 97,245,978 E332G possibly damaging Het
Fat2 C T 11: 55,256,780 V3879I probably benign Het
Fh1 A T 1: 175,616,548 I117K probably damaging Het
Fkbp15 A G 4: 62,337,091 L227P probably damaging Het
Fpr1 T A 17: 17,877,053 M225L probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Grm7 A G 6: 111,207,769 T354A probably benign Het
Ift27 T A 15: 78,173,778 I9F possibly damaging Het
Igf1r A G 7: 68,194,981 D834G possibly damaging Het
Igsf9b T A 9: 27,331,732 L738Q probably damaging Het
Itgam A T 7: 128,064,732 T44S probably benign Het
Ivd T A 2: 118,862,034 I5N probably benign Het
Jcad T C 18: 4,675,780 S1181P probably damaging Het
Kctd18 A G 1: 57,956,365 V251A probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo18a T C 11: 77,825,097 probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myocd C A 11: 65,178,670 M909I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Nkpd1 G A 7: 19,523,252 V319M probably damaging Het
Olfr1216 A G 2: 89,013,378 S229P probably benign Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Olfr1453 C A 19: 13,027,817 V171L probably benign Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr366 T C 2: 37,220,332 V281A probably damaging Het
Olfr406 C T 11: 74,270,217 A276V probably damaging Het
Olfr450 G T 6: 42,818,268 A266S possibly damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pcdhb9 A G 18: 37,402,818 T622A probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 G T 10: 3,903,658 probably null Het
Plekhh2 A G 17: 84,575,189 Y708C probably damaging Het
Pnp T C 14: 50,950,329 F107L probably damaging Het
Prcp A T 7: 92,928,675 D349V probably damaging Het
Prl3a1 A T 13: 27,270,194 I52F probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Rad9a A T 19: 4,197,242 I248N probably damaging Het
Ror2 T G 13: 53,110,305 E917A probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sema6d A G 2: 124,659,556 probably null Het
Slc4a2 C T 5: 24,427,620 A12V probably damaging Het
Slco6b1 T G 1: 96,961,176 noncoding transcript Het
Slf2 A T 19: 44,935,248 H167L possibly damaging Het
Snx9 G T 17: 5,920,671 G429V probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Spta1 T A 1: 174,246,549 D2351E probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Tatdn1 C T 15: 58,916,156 G171E probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tpm3-rs7 T C 14: 113,315,163 L163P possibly damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Ucp1 C T 8: 83,294,032 T157I probably damaging Het
Uspl1 T A 5: 149,214,414 L794Q probably benign Het
Vmn1r5 T A 6: 56,985,595 V85E probably damaging Het
Vmn1r58 A G 7: 5,410,406 I275T possibly damaging Het
Vmn2r79 A G 7: 87,037,872 I820M probably damaging Het
Wscd1 C A 11: 71,760,218 P124T probably benign Het
Zfp780b A T 7: 27,963,100 C677S possibly damaging Het
Other mutations in Postn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Postn APN 3 54373728 missense probably damaging 1.00
IGL00567:Postn APN 3 54384523 missense probably benign
IGL00742:Postn APN 3 54372894 missense possibly damaging 0.81
IGL00971:Postn APN 3 54369276 missense possibly damaging 0.88
IGL01105:Postn APN 3 54362710 missense probably damaging 1.00
IGL01460:Postn APN 3 54375158 unclassified probably benign
IGL01609:Postn APN 3 54369228 missense probably damaging 0.99
IGL01878:Postn APN 3 54383480 splice site probably null
IGL01885:Postn APN 3 54376034 unclassified probably benign
IGL02040:Postn APN 3 54362689 missense probably benign
IGL02431:Postn APN 3 54375096 missense probably damaging 0.99
IGL02578:Postn APN 3 54377204 missense possibly damaging 0.93
IGL02943:Postn APN 3 54377608 critical splice donor site probably null
IGL03307:Postn APN 3 54375127 missense probably benign 0.32
sticklike UTSW 3 54372106 missense probably damaging 1.00
R0117:Postn UTSW 3 54383481 splice site probably benign
R0270:Postn UTSW 3 54384550 missense probably damaging 0.98
R0410:Postn UTSW 3 54385277 missense possibly damaging 0.93
R0548:Postn UTSW 3 54367576 nonsense probably null
R0734:Postn UTSW 3 54362715 missense probably damaging 1.00
R1648:Postn UTSW 3 54376101 missense probably damaging 1.00
R1796:Postn UTSW 3 54373756 missense probably damaging 1.00
R1938:Postn UTSW 3 54377612 splice site probably null
R2311:Postn UTSW 3 54385223 missense probably damaging 0.98
R2566:Postn UTSW 3 54376953 missense probably damaging 0.97
R2938:Postn UTSW 3 54370310 missense probably damaging 1.00
R4105:Postn UTSW 3 54376041 missense probably damaging 1.00
R4394:Postn UTSW 3 54370955 missense probably damaging 1.00
R4620:Postn UTSW 3 54376993 missense probably damaging 1.00
R4628:Postn UTSW 3 54372157 missense probably damaging 1.00
R4697:Postn UTSW 3 54375071 missense probably damaging 1.00
R4709:Postn UTSW 3 54384610 intron probably benign
R4952:Postn UTSW 3 54390315 utr 3 prime probably benign
R5303:Postn UTSW 3 54377597 missense probably damaging 1.00
R5704:Postn UTSW 3 54372106 missense probably damaging 1.00
R5902:Postn UTSW 3 54372089 missense probably benign 0.03
R5914:Postn UTSW 3 54373800 nonsense probably null
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6101:Postn UTSW 3 54372220 splice site probably null
R6105:Postn UTSW 3 54372220 splice site probably null
R6334:Postn UTSW 3 54385282 missense probably benign
R7131:Postn UTSW 3 54362635 missense probably damaging 1.00
R7322:Postn UTSW 3 54370280 missense probably damaging 1.00
R7430:Postn UTSW 3 54370202 missense probably damaging 1.00
R7497:Postn UTSW 3 54362670 missense probably damaging 1.00
X0004:Postn UTSW 3 54362694 missense probably damaging 1.00
X0022:Postn UTSW 3 54370840 missense probably benign 0.03
Z1088:Postn UTSW 3 54375127 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CTTTGTGTGAGACTTACATCGATG -3'
(R):5'- CAAACCATCTGCGTGGGTAC -3'

Sequencing Primer
(F):5'- GCAATAAGCTTTTCTGGAGCACAG -3'
(R):5'- AATGACCCCTTATGCTGG -3'
Posted On2014-06-23