Incidental Mutation 'R1823:Olfr1342'
ID 206555
Institutional Source Beutler Lab
Gene Symbol Olfr1342
Ensembl Gene ENSMUSG00000043383
Gene Name olfactory receptor 1342
Synonyms GA_x6K02T2QD9B-18856980-18857927, MOR258-3
MMRRC Submission 039851-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R1823 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118687486-118692756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118690192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 87 (N87Y)
Ref Sequence ENSEMBL: ENSMUSP00000149966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060562] [ENSMUST00000216226]
AlphaFold Q8VFY3
Predicted Effect probably damaging
Transcript: ENSMUST00000060562
AA Change: N87Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053925
Gene: ENSMUSG00000043383
AA Change: N87Y

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:7tm_4 34 311 1.5e-55 PFAM
Pfam:7TM_GPCR_Srsx 38 243 1.6e-5 PFAM
Pfam:7tm_1 44 293 4.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216226
AA Change: N87Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T C 15: 84,406,468 T213A probably benign Het
Adcy1 G A 11: 7,161,312 V868I probably benign Het
Ahnak G T 19: 9,004,905 M1184I probably damaging Het
Akap11 T C 14: 78,511,488 E1153G probably damaging Het
Amy1 T C 3: 113,562,727 N260S probably null Het
Ankrd6 A G 4: 32,824,427 L129P probably damaging Het
Aox2 A T 1: 58,312,359 T702S probably benign Het
Apobec1 G T 6: 122,578,886 T204K possibly damaging Het
Arhgef19 A G 4: 141,249,146 R433G probably benign Het
Atf6b T A 17: 34,648,644 H110Q possibly damaging Het
Btnl4 C T 17: 34,475,852 probably null Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cbs G A 17: 31,624,271 H229Y probably damaging Het
Cct8 G A 16: 87,490,554 R111* probably null Het
Cdc42bpb C T 12: 111,327,559 A250T probably damaging Het
Chrd A G 16: 20,741,347 probably benign Het
Ckap2l A G 2: 129,275,579 F559L probably damaging Het
D630003M21Rik T C 2: 158,217,557 Y141C probably damaging Het
Dbf4 T C 5: 8,397,539 N557S probably benign Het
Dct T G 14: 118,036,523 N324T probably benign Het
Dip2a A T 10: 76,278,502 L999* probably null Het
Dock10 T A 1: 80,543,097 probably null Het
Dync2li1 A T 17: 84,649,797 D330V probably damaging Het
Eif4g3 T A 4: 138,180,491 D1267E probably benign Het
Enc1 A G 13: 97,245,978 E332G possibly damaging Het
Fat2 C T 11: 55,256,780 V3879I probably benign Het
Fh1 A T 1: 175,616,548 I117K probably damaging Het
Fkbp15 A G 4: 62,337,091 L227P probably damaging Het
Fpr1 T A 17: 17,877,053 M225L probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Grm7 A G 6: 111,207,769 T354A probably benign Het
Ift27 T A 15: 78,173,778 I9F possibly damaging Het
Igf1r A G 7: 68,194,981 D834G possibly damaging Het
Igsf9b T A 9: 27,331,732 L738Q probably damaging Het
Itgam A T 7: 128,064,732 T44S probably benign Het
Ivd T A 2: 118,862,034 I5N probably benign Het
Jcad T C 18: 4,675,780 S1181P probably damaging Het
Kctd18 A G 1: 57,956,365 V251A probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo18a T C 11: 77,825,097 probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myocd C A 11: 65,178,670 M909I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Nkpd1 G A 7: 19,523,252 V319M probably damaging Het
Olfr1216 A G 2: 89,013,378 S229P probably benign Het
Olfr1453 C A 19: 13,027,817 V171L probably benign Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr366 T C 2: 37,220,332 V281A probably damaging Het
Olfr406 C T 11: 74,270,217 A276V probably damaging Het
Olfr450 G T 6: 42,818,268 A266S possibly damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pcdhb9 A G 18: 37,402,818 T622A probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 G T 10: 3,903,658 probably null Het
Plekhh2 A G 17: 84,575,189 Y708C probably damaging Het
Pnp T C 14: 50,950,329 F107L probably damaging Het
Postn T A 3: 54,385,287 probably null Het
Prcp A T 7: 92,928,675 D349V probably damaging Het
Prl3a1 A T 13: 27,270,194 I52F probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Rad9a A T 19: 4,197,242 I248N probably damaging Het
Ror2 T G 13: 53,110,305 E917A probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sema6d A G 2: 124,659,556 probably null Het
Slc4a2 C T 5: 24,427,620 A12V probably damaging Het
Slco6b1 T G 1: 96,961,176 noncoding transcript Het
Slf2 A T 19: 44,935,248 H167L possibly damaging Het
Snx9 G T 17: 5,920,671 G429V probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Spta1 T A 1: 174,246,549 D2351E probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Tatdn1 C T 15: 58,916,156 G171E probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tpm3-rs7 T C 14: 113,315,163 L163P possibly damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Ucp1 C T 8: 83,294,032 T157I probably damaging Het
Uspl1 T A 5: 149,214,414 L794Q probably benign Het
Vmn1r5 T A 6: 56,985,595 V85E probably damaging Het
Vmn1r58 A G 7: 5,410,406 I275T possibly damaging Het
Vmn2r79 A G 7: 87,037,872 I820M probably damaging Het
Wscd1 C A 11: 71,760,218 P124T probably benign Het
Zfp780b A T 7: 27,963,100 C677S possibly damaging Het
Other mutations in Olfr1342
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Olfr1342 APN 4 118689721 missense probably damaging 1.00
IGL02391:Olfr1342 APN 4 118690341 missense probably damaging 1.00
R0648:Olfr1342 UTSW 4 118690072 missense probably benign
R1565:Olfr1342 UTSW 4 118690192 missense probably damaging 1.00
R1675:Olfr1342 UTSW 4 118689948 missense probably benign 0.00
R2343:Olfr1342 UTSW 4 118690187 missense probably benign 0.30
R4618:Olfr1342 UTSW 4 118689470 utr 3 prime probably benign
R4941:Olfr1342 UTSW 4 118689892 missense possibly damaging 0.76
R5408:Olfr1342 UTSW 4 118690444 missense probably benign 0.00
R5587:Olfr1342 UTSW 4 118689870 missense probably damaging 1.00
R5895:Olfr1342 UTSW 4 118690117 missense probably damaging 0.97
R6023:Olfr1342 UTSW 4 118690074 missense probably damaging 1.00
R6307:Olfr1342 UTSW 4 118689948 missense probably benign 0.00
R6324:Olfr1342 UTSW 4 118690531 start gained probably benign
R6890:Olfr1342 UTSW 4 118689531 missense possibly damaging 0.72
R7218:Olfr1342 UTSW 4 118690018 missense probably benign
R7408:Olfr1342 UTSW 4 118689662 missense probably damaging 0.98
R7555:Olfr1342 UTSW 4 118689642 missense possibly damaging 0.94
R7749:Olfr1342 UTSW 4 118690228 missense probably damaging 1.00
R8098:Olfr1342 UTSW 4 118690209 missense possibly damaging 0.88
R8493:Olfr1342 UTSW 4 118690032 missense probably benign 0.01
Z1176:Olfr1342 UTSW 4 118690272 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ATCAGAGCACCAGTGATGC -3'
(R):5'- GGTCAGAGTGGCCCTGTTTATC -3'

Sequencing Primer
(F):5'- AGCAGACTGTGACCATCTTG -3'
(R):5'- GCTCATCATCACCCTGAT -3'
Posted On 2014-06-23