Mutagenetix > Incidental Mutation

Incidental Mutation 'R1823:Grm7'

206567

Institutional Source

Beutler Lab

Gene Symbol

Grm7

Ensembl Gene

ENSMUSG00000056755

Gene Name

glutamate receptor, metabotropic 7

Synonyms

Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik

MMRRC Submission

039851-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1823 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110645581-111567230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 111207769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 354 (T354A)

Ref Sequence

ENSEMBL: ENSMUSP00000064404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]

AlphaFold

Q68ED2

Predicted Effect

probably benign
Transcript: ENSMUST00000071076
AA Change: T354A

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: T354A

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172951
AA Change: T354A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: T354A

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174018

SMART Domains

Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

Meta Mutation Damage Score

0.0929

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.6%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	T	C	15: 84,406,468	T213A	probably benign	Het
Adcy1	G	A	11: 7,161,312	V868I	probably benign	Het
Ahnak	G	T	19: 9,004,905	M1184I	probably damaging	Het
Akap11	T	C	14: 78,511,488	E1153G	probably damaging	Het
Amy1	T	C	3: 113,562,727	N260S	probably null	Het
Ankrd6	A	G	4: 32,824,427	L129P	probably damaging	Het
Aox2	A	T	1: 58,312,359	T702S	probably benign	Het
Apobec1	G	T	6: 122,578,886	T204K	possibly damaging	Het
Arhgef19	A	G	4: 141,249,146	R433G	probably benign	Het
Atf6b	T	A	17: 34,648,644	H110Q	possibly damaging	Het
Btnl4	C	T	17: 34,475,852		probably null	Het
Camsap2	T	C	1: 136,273,783	T662A	possibly damaging	Het
Cbs	G	A	17: 31,624,271	H229Y	probably damaging	Het
Cct8	G	A	16: 87,490,554	R111*	probably null	Het
Cdc42bpb	C	T	12: 111,327,559	A250T	probably damaging	Het
Chrd	A	G	16: 20,741,347		probably benign	Het
Ckap2l	A	G	2: 129,275,579	F559L	probably damaging	Het
D630003M21Rik	T	C	2: 158,217,557	Y141C	probably damaging	Het
Dbf4	T	C	5: 8,397,539	N557S	probably benign	Het
Dct	T	G	14: 118,036,523	N324T	probably benign	Het
Dip2a	A	T	10: 76,278,502	L999*	probably null	Het
Dock10	T	A	1: 80,543,097		probably null	Het
Dync2li1	A	T	17: 84,649,797	D330V	probably damaging	Het
Eif4g3	T	A	4: 138,180,491	D1267E	probably benign	Het
Enc1	A	G	13: 97,245,978	E332G	possibly damaging	Het
Fat2	C	T	11: 55,256,780	V3879I	probably benign	Het
Fh1	A	T	1: 175,616,548	I117K	probably damaging	Het
Fkbp15	A	G	4: 62,337,091	L227P	probably damaging	Het
Fpr1	T	A	17: 17,877,053	M225L	probably benign	Het
Fras1	A	T	5: 96,770,688	I3528F	probably damaging	Het
Ift27	T	A	15: 78,173,778	I9F	possibly damaging	Het
Igf1r	A	G	7: 68,194,981	D834G	possibly damaging	Het
Igsf9b	T	A	9: 27,331,732	L738Q	probably damaging	Het
Itgam	A	T	7: 128,064,732	T44S	probably benign	Het
Ivd	T	A	2: 118,862,034	I5N	probably benign	Het
Jcad	T	C	18: 4,675,780	S1181P	probably damaging	Het
Kctd18	A	G	1: 57,956,365	V251A	probably benign	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo18a	T	C	11: 77,825,097		probably benign	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myocd	C	A	11: 65,178,670	M909I	probably benign	Het
Ndufv3	G	A	17: 31,531,245	R467Q	probably damaging	Het
Nkpd1	G	A	7: 19,523,252	V319M	probably damaging	Het
Olfr1216	A	G	2: 89,013,378	S229P	probably benign	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Olfr1453	C	A	19: 13,027,817	V171L	probably benign	Het
Olfr31	T	A	14: 14,328,774	L221Q	probably damaging	Het
Olfr366	T	C	2: 37,220,332	V281A	probably damaging	Het
Olfr406	C	T	11: 74,270,217	A276V	probably damaging	Het
Olfr450	G	T	6: 42,818,268	A266S	possibly damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pcdhb9	A	G	18: 37,402,818	T622A	probably benign	Het
Pdpk1	A	T	17: 24,098,176		probably benign	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	G	T	10: 3,903,658		probably null	Het
Plekhh2	A	G	17: 84,575,189	Y708C	probably damaging	Het
Pnp	T	C	14: 50,950,329	F107L	probably damaging	Het
Postn	T	A	3: 54,385,287		probably null	Het
Prcp	A	T	7: 92,928,675	D349V	probably damaging	Het
Prl3a1	A	T	13: 27,270,194	I52F	probably damaging	Het
Pym1	G	A	10: 128,766,044		probably benign	Het
Rad9a	A	T	19: 4,197,242	I248N	probably damaging	Het
Ror2	T	G	13: 53,110,305	E917A	probably benign	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sema6d	A	G	2: 124,659,556		probably null	Het
Slc4a2	C	T	5: 24,427,620	A12V	probably damaging	Het
Slco6b1	T	G	1: 96,961,176		noncoding transcript	Het
Slf2	A	T	19: 44,935,248	H167L	possibly damaging	Het
Snx9	G	T	17: 5,920,671	G429V	probably damaging	Het
Sod3	G	T	5: 52,368,162	V68L	probably benign	Het
Spta1	T	A	1: 174,246,549	D2351E	probably benign	Het
Srpk3	G	A	X: 73,777,955	R425Q	possibly damaging	Het
Tatdn1	C	T	15: 58,916,156	G171E	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnfsf9	A	G	17: 57,105,738	T103A	probably benign	Het
Tpm3-rs7	T	C	14: 113,315,163	L163P	possibly damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Ucp1	C	T	8: 83,294,032	T157I	probably damaging	Het
Uspl1	T	A	5: 149,214,414	L794Q	probably benign	Het
Vmn1r5	T	A	6: 56,985,595	V85E	probably damaging	Het
Vmn1r58	A	G	7: 5,410,406	I275T	possibly damaging	Het
Vmn2r79	A	G	7: 87,037,872	I820M	probably damaging	Het
Wscd1	C	A	11: 71,760,218	P124T	probably benign	Het
Zfp780b	A	T	7: 27,963,100	C677S	possibly damaging	Het

Other mutations in Grm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Grm7	APN	6	111246184	missense	probably benign	0.14
IGL02058:Grm7	APN	6	111358317	missense	probably damaging	1.00
IGL02650:Grm7	APN	6	111358958	missense	probably damaging	1.00
IGL02892:Grm7	APN	6	111254020	missense	probably damaging	0.99
IGL03074:Grm7	APN	6	111495643	splice site	probably null
IGL03185:Grm7	APN	6	110646222	missense	possibly damaging	0.84
Appropriated	UTSW	6	111495681	missense	possibly damaging	0.64
Consumed	UTSW	6	111358875	missense	probably damaging	1.00
Devoured	UTSW	6	111358824	missense	probably damaging	1.00
Ravaged	UTSW	6	111358913	missense	probably damaging	1.00
shaky	UTSW	6	111495791	nonsense	probably null
PIT4651001:Grm7	UTSW	6	110646089	missense	probably benign
R0539:Grm7	UTSW	6	111359094	splice site	probably benign
R0622:Grm7	UTSW	6	111358496	missense	probably damaging	1.00
R1356:Grm7	UTSW	6	111359024	missense	probably damaging	1.00
R1762:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1783:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1785:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1816:Grm7	UTSW	6	111495791	nonsense	probably null
R1864:Grm7	UTSW	6	111080423	missense	probably benign	0.03
R1894:Grm7	UTSW	6	111358607	missense	probably benign
R1987:Grm7	UTSW	6	110914511	missense	probably damaging	1.00
R1993:Grm7	UTSW	6	111207808	missense	probably benign	0.13
R2138:Grm7	UTSW	6	110646137	missense	probably damaging	1.00
R2214:Grm7	UTSW	6	111358997	missense	probably damaging	1.00
R2289:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2296:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2339:Grm7	UTSW	6	111495681	missense	possibly damaging	0.64
R2847:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2849:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2879:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2884:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2921:Grm7	UTSW	6	111495905	splice site	probably null
R2923:Grm7	UTSW	6	111495905	splice site	probably null
R3014:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3015:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3703:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3713:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3963:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4009:Grm7	UTSW	6	111495722	missense	probably damaging	1.00
R4091:Grm7	UTSW	6	110914340	missense	probably damaging	1.00
R4131:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4132:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4161:Grm7	UTSW	6	111254020	missense	probably damaging	0.99
R4329:Grm7	UTSW	6	110914364	missense	probably damaging	1.00
R4357:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4359:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	111246374	missense	probably benign	0.05
R4380:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4514:Grm7	UTSW	6	111358304	missense	possibly damaging	0.81
R4518:Grm7	UTSW	6	110914546	splice site	probably null
R4647:Grm7	UTSW	6	110914383	nonsense	probably null
R4714:Grm7	UTSW	6	111080422	missense	possibly damaging	0.52
R4775:Grm7	UTSW	6	110914371	missense	probably damaging	1.00
R4957:Grm7	UTSW	6	111358863	missense	probably damaging	1.00
R5056:Grm7	UTSW	6	111080443	missense	probably damaging	0.99
R5062:Grm7	UTSW	6	110646136	missense	probably damaging	1.00
R5256:Grm7	UTSW	6	111358221	missense	probably benign	0.01
R5431:Grm7	UTSW	6	111358426	missense	probably benign
R6026:Grm7	UTSW	6	111501539	nonsense	probably null
R6174:Grm7	UTSW	6	111246297	missense	probably benign
R6305:Grm7	UTSW	6	111358665	missense	probably damaging	1.00
R6318:Grm7	UTSW	6	111358875	missense	probably damaging	1.00
R6440:Grm7	UTSW	6	111254020	missense	probably damaging	1.00
R6519:Grm7	UTSW	6	111207752	missense	probably benign	0.00
R6531:Grm7	UTSW	6	111358425	missense	probably benign	0.29
R6888:Grm7	UTSW	6	111358353	missense	possibly damaging	0.79
R6949:Grm7	UTSW	6	110646304	missense	probably benign	0.03
R6949:Grm7	UTSW	6	111495729	missense	probably damaging	1.00
R6989:Grm7	UTSW	6	111207805	missense	probably damaging	1.00
R7076:Grm7	UTSW	6	111358152	missense	probably benign	0.04
R7203:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7208:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7217:Grm7	UTSW	6	111358824	missense	probably damaging	1.00
R7257:Grm7	UTSW	6	110646118	missense	probably damaging	1.00
R7297:Grm7	UTSW	6	110646013	missense	probably benign	0.16
R7470:Grm7	UTSW	6	111501515	missense
R7567:Grm7	UTSW	6	111358761	missense	probably damaging	0.96
R7806:Grm7	UTSW	6	111246353	nonsense	probably null
R8018:Grm7	UTSW	6	111207776	missense	probably benign	0.01
R8076:Grm7	UTSW	6	111566039	missense	probably damaging	1.00
R8409:Grm7	UTSW	6	110914336	missense	probably benign	0.02
R8420:Grm7	UTSW	6	111080354	missense	probably benign
R8523:Grm7	UTSW	6	111246319	missense	possibly damaging	0.76
R8816:Grm7	UTSW	6	111254005	missense	possibly damaging	0.46
R8958:Grm7	UTSW	6	111495822	missense	probably damaging	0.96
R9135:Grm7	UTSW	6	111495768	missense	probably benign	0.39
R9207:Grm7	UTSW	6	111358913	missense	probably damaging	1.00
R9210:Grm7	UTSW	6	110645908	missense	probably benign	0.01
R9438:Grm7	UTSW	6	111254116	missense	possibly damaging	0.94
R9448:Grm7	UTSW	6	111358232	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111358149	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111358490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCTGATTTAGCTCACTAGAAATG -3'
(R):5'- GTCAGCATGCAAATGTCTCAGTG -3'

Sequencing Primer
(F):5'- TGGGTCTTCAGTGAAAATAAAGC -3'
(R):5'- CAGCATGCAAATGTCTCAGTGTTTTC -3'

Posted On

2014-06-23