Incidental Mutation 'R1823:Grm7'
ID206567
Institutional Source Beutler Lab
Gene Symbol Grm7
Ensembl Gene ENSMUSG00000056755
Gene Nameglutamate receptor, metabotropic 7
SynonymsGpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik
MMRRC Submission 039851-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1823 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location110645581-111567230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111207769 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 354 (T354A)
Ref Sequence ENSEMBL: ENSMUSP00000064404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]
Predicted Effect probably benign
Transcript: ENSMUST00000071076
AA Change: T354A

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: T354A

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 3e-108 PFAM
Pfam:Peripla_BP_6 144 371 3e-11 PFAM
Pfam:NCD3G 519 569 1.2e-13 PFAM
Pfam:7tm_3 602 847 5.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172951
AA Change: T354A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: T354A

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 1.7e-103 PFAM
Pfam:Peripla_BP_6 144 487 1e-12 PFAM
Pfam:NCD3G 519 569 1.2e-17 PFAM
Pfam:7tm_3 600 848 1.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174018
SMART Domains Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 176 4.9e-20 PFAM
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T C 15: 84,406,468 T213A probably benign Het
Adcy1 G A 11: 7,161,312 V868I probably benign Het
Ahnak G T 19: 9,004,905 M1184I probably damaging Het
Akap11 T C 14: 78,511,488 E1153G probably damaging Het
Amy1 T C 3: 113,562,727 N260S probably null Het
Ankrd6 A G 4: 32,824,427 L129P probably damaging Het
Aox2 A T 1: 58,312,359 T702S probably benign Het
Apobec1 G T 6: 122,578,886 T204K possibly damaging Het
Arhgef19 A G 4: 141,249,146 R433G probably benign Het
Atf6b T A 17: 34,648,644 H110Q possibly damaging Het
Btnl4 C T 17: 34,475,852 probably null Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cbs G A 17: 31,624,271 H229Y probably damaging Het
Cct8 G A 16: 87,490,554 R111* probably null Het
Cdc42bpb C T 12: 111,327,559 A250T probably damaging Het
Chrd A G 16: 20,741,347 probably benign Het
Ckap2l A G 2: 129,275,579 F559L probably damaging Het
D630003M21Rik T C 2: 158,217,557 Y141C probably damaging Het
Dbf4 T C 5: 8,397,539 N557S probably benign Het
Dct T G 14: 118,036,523 N324T probably benign Het
Dip2a A T 10: 76,278,502 L999* probably null Het
Dock10 T A 1: 80,543,097 probably null Het
Dync2li1 A T 17: 84,649,797 D330V probably damaging Het
Eif4g3 T A 4: 138,180,491 D1267E probably benign Het
Enc1 A G 13: 97,245,978 E332G possibly damaging Het
Fat2 C T 11: 55,256,780 V3879I probably benign Het
Fh1 A T 1: 175,616,548 I117K probably damaging Het
Fkbp15 A G 4: 62,337,091 L227P probably damaging Het
Fpr1 T A 17: 17,877,053 M225L probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Ift27 T A 15: 78,173,778 I9F possibly damaging Het
Igf1r A G 7: 68,194,981 D834G possibly damaging Het
Igsf9b T A 9: 27,331,732 L738Q probably damaging Het
Itgam A T 7: 128,064,732 T44S probably benign Het
Ivd T A 2: 118,862,034 I5N probably benign Het
Jcad T C 18: 4,675,780 S1181P probably damaging Het
Kctd18 A G 1: 57,956,365 V251A probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo18a T C 11: 77,825,097 probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myocd C A 11: 65,178,670 M909I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Nkpd1 G A 7: 19,523,252 V319M probably damaging Het
Olfr1216 A G 2: 89,013,378 S229P probably benign Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Olfr1453 C A 19: 13,027,817 V171L probably benign Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr366 T C 2: 37,220,332 V281A probably damaging Het
Olfr406 C T 11: 74,270,217 A276V probably damaging Het
Olfr450 G T 6: 42,818,268 A266S possibly damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pcdhb9 A G 18: 37,402,818 T622A probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 G T 10: 3,903,658 probably null Het
Plekhh2 A G 17: 84,575,189 Y708C probably damaging Het
Pnp T C 14: 50,950,329 F107L probably damaging Het
Postn T A 3: 54,385,287 probably null Het
Prcp A T 7: 92,928,675 D349V probably damaging Het
Prl3a1 A T 13: 27,270,194 I52F probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Rad9a A T 19: 4,197,242 I248N probably damaging Het
Ror2 T G 13: 53,110,305 E917A probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sema6d A G 2: 124,659,556 probably null Het
Slc4a2 C T 5: 24,427,620 A12V probably damaging Het
Slco6b1 T G 1: 96,961,176 noncoding transcript Het
Slf2 A T 19: 44,935,248 H167L possibly damaging Het
Snx9 G T 17: 5,920,671 G429V probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Spta1 T A 1: 174,246,549 D2351E probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Tatdn1 C T 15: 58,916,156 G171E probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tpm3-rs7 T C 14: 113,315,163 L163P possibly damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Ucp1 C T 8: 83,294,032 T157I probably damaging Het
Uspl1 T A 5: 149,214,414 L794Q probably benign Het
Vmn1r5 T A 6: 56,985,595 V85E probably damaging Het
Vmn1r58 A G 7: 5,410,406 I275T possibly damaging Het
Vmn2r79 A G 7: 87,037,872 I820M probably damaging Het
Wscd1 C A 11: 71,760,218 P124T probably benign Het
Zfp780b A T 7: 27,963,100 C677S possibly damaging Het
Other mutations in Grm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Grm7 APN 6 111246184 missense probably benign 0.14
IGL02058:Grm7 APN 6 111358317 missense probably damaging 1.00
IGL02650:Grm7 APN 6 111358958 missense probably damaging 1.00
IGL02892:Grm7 APN 6 111254020 missense probably damaging 0.99
IGL03074:Grm7 APN 6 111495643 splice site probably null
IGL03185:Grm7 APN 6 110646222 missense possibly damaging 0.84
Appropriated UTSW 6 111495681 missense possibly damaging 0.64
Consumed UTSW 6 111358875 missense probably damaging 1.00
Devoured UTSW 6 111358824 missense probably damaging 1.00
shaky UTSW 6 111495791 nonsense probably null
PIT4651001:Grm7 UTSW 6 110646089 missense probably benign
R0539:Grm7 UTSW 6 111359094 splice site probably benign
R0622:Grm7 UTSW 6 111358496 missense probably damaging 1.00
R1356:Grm7 UTSW 6 111359024 missense probably damaging 1.00
R1762:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1783:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1785:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1816:Grm7 UTSW 6 111495791 nonsense probably null
R1864:Grm7 UTSW 6 111080423 missense probably benign 0.03
R1894:Grm7 UTSW 6 111358607 missense probably benign
R1987:Grm7 UTSW 6 110914511 missense probably damaging 1.00
R1993:Grm7 UTSW 6 111207808 missense probably benign 0.13
R2138:Grm7 UTSW 6 110646137 missense probably damaging 1.00
R2214:Grm7 UTSW 6 111358997 missense probably damaging 1.00
R2289:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2296:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2339:Grm7 UTSW 6 111495681 missense possibly damaging 0.64
R2847:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2849:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2879:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2884:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2921:Grm7 UTSW 6 111495905 splice site probably null
R2923:Grm7 UTSW 6 111495905 splice site probably null
R3014:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3015:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3703:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3713:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3963:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4009:Grm7 UTSW 6 111495722 missense probably damaging 1.00
R4091:Grm7 UTSW 6 110914340 missense probably damaging 1.00
R4131:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4132:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4161:Grm7 UTSW 6 111254020 missense probably damaging 0.99
R4329:Grm7 UTSW 6 110914364 missense probably damaging 1.00
R4357:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4359:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 111246374 missense probably benign 0.05
R4380:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4514:Grm7 UTSW 6 111358304 missense possibly damaging 0.81
R4518:Grm7 UTSW 6 110914546 splice site probably null
R4647:Grm7 UTSW 6 110914383 nonsense probably null
R4714:Grm7 UTSW 6 111080422 missense possibly damaging 0.52
R4775:Grm7 UTSW 6 110914371 missense probably damaging 1.00
R4957:Grm7 UTSW 6 111358863 missense probably damaging 1.00
R5056:Grm7 UTSW 6 111080443 missense probably damaging 0.99
R5062:Grm7 UTSW 6 110646136 missense probably damaging 1.00
R5256:Grm7 UTSW 6 111358221 missense probably benign 0.01
R5431:Grm7 UTSW 6 111358426 missense probably benign
R6026:Grm7 UTSW 6 111501539 nonsense probably null
R6174:Grm7 UTSW 6 111246297 missense probably benign
R6305:Grm7 UTSW 6 111358665 missense probably damaging 1.00
R6318:Grm7 UTSW 6 111358875 missense probably damaging 1.00
R6440:Grm7 UTSW 6 111254020 missense probably damaging 1.00
R6519:Grm7 UTSW 6 111207752 missense probably benign 0.00
R6531:Grm7 UTSW 6 111358425 missense probably benign 0.29
R6888:Grm7 UTSW 6 111358353 missense possibly damaging 0.79
R6949:Grm7 UTSW 6 110646304 missense probably benign 0.03
R6949:Grm7 UTSW 6 111495729 missense probably damaging 1.00
R6989:Grm7 UTSW 6 111207805 missense probably damaging 1.00
R7076:Grm7 UTSW 6 111358152 missense probably benign 0.04
R7203:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7208:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7217:Grm7 UTSW 6 111358824 missense probably damaging 1.00
R7257:Grm7 UTSW 6 110646118 missense probably damaging 1.00
R7297:Grm7 UTSW 6 110646013 missense probably benign 0.16
R7470:Grm7 UTSW 6 111501515 missense
R7567:Grm7 UTSW 6 111358761 missense probably damaging 0.96
R7806:Grm7 UTSW 6 111246353 nonsense probably null
R8018:Grm7 UTSW 6 111207776 missense probably benign 0.01
R8076:Grm7 UTSW 6 111566039 missense probably damaging 1.00
R8409:Grm7 UTSW 6 110914336 missense probably benign 0.02
R8420:Grm7 UTSW 6 111080354 missense probably benign
R8523:Grm7 UTSW 6 111246319 missense possibly damaging 0.76
Z1176:Grm7 UTSW 6 111358149 missense probably benign 0.01
Z1176:Grm7 UTSW 6 111358490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGATTTAGCTCACTAGAAATG -3'
(R):5'- GTCAGCATGCAAATGTCTCAGTG -3'

Sequencing Primer
(F):5'- TGGGTCTTCAGTGAAAATAAAGC -3'
(R):5'- CAGCATGCAAATGTCTCAGTGTTTTC -3'
Posted On2014-06-23