Mutagenetix > Incidental Mutation

Incidental Mutation 'R0114:Itga11'

20657

Institutional Source

Beutler Lab

Gene Symbol

Itga11

Ensembl Gene

ENSMUSG00000032243

Gene Name

integrin alpha 11

Synonyms

MMRRC Submission

038400-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R0114 (G1)

Quality Score

203

Status

Validated

Chromosome

Chromosomal Location

62677826-62783982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 62735293 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 166 (V166G)

Ref Sequence

ENSEMBL: ENSMUSP00000034774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034774]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034774
AA Change: V166G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: V166G

Domain	Start	End	E-Value	Type
Int_alpha	37	90	3.9e-7	SMART
VWA	162	350	2.74e-38	SMART
Int_alpha	421	472	2.19e-1	SMART
Int_alpha	476	532	3.75e-9	SMART
Int_alpha	538	593	1.39e-12	SMART
Int_alpha	600	654	1.08e0	SMART
transmembrane domain	1142	1164	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159012

Meta Mutation Damage Score

0.8222

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 93.2%
20x: 79.2%

Validation Efficiency

100% (99/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	C	10: 28,985,982		probably benign	Het
4933427D14Rik	T	C	11: 72,195,799	Y262C	probably damaging	Het
Adamts1	C	A	16: 85,799,614	V379L	probably benign	Het
Akt3	T	C	1: 177,067,251	D260G	probably damaging	Het
Alms1	T	C	6: 85,619,803	L537P	probably benign	Het
Anln	A	T	9: 22,353,346	I876N	probably damaging	Het
Ano9	A	T	7: 141,103,239		probably benign	Het
Arhgef10l	T	C	4: 140,583,883	E218G	probably benign	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Atp9a	G	T	2: 168,710,856	Y63*	probably null	Het
Bmpr2	G	T	1: 59,815,340	C116F	probably damaging	Het
Cand1	T	C	10: 119,216,522	D233G	probably benign	Het
Cftr	A	T	6: 18,282,448	H1049L	probably damaging	Het
Ckap5	A	T	2: 91,620,112	D1975V	possibly damaging	Het
Cyp26c1	T	C	19: 37,686,633	V134A	probably benign	Het
Dnaic1	T	C	4: 41,605,686		probably benign	Het
Dpp10	T	C	1: 123,486,092	I163V	probably benign	Het
Fam151a	A	T	4: 106,734,004	I15F	possibly damaging	Het
Fanca	A	T	8: 123,288,491		probably null	Het
Fes	A	G	7: 80,378,035	V787A	probably damaging	Het
Fnip1	C	T	11: 54,487,801		probably benign	Het
Gabpb1	A	G	2: 126,653,574	I86T	probably damaging	Het
Gm1840	A	G	8: 5,640,359		noncoding transcript	Het
Gmds	A	T	13: 32,227,281	S57T	probably benign	Het
Gnpat	T	G	8: 124,883,357	D426E	probably benign	Het
Gnptab	C	A	10: 88,433,400	P655Q	possibly damaging	Het
Herc1	T	A	9: 66,461,846	F2941I	probably damaging	Het
Herc2	T	C	7: 56,153,774		probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Itpr2	A	G	6: 146,312,879	F1490S	probably damaging	Het
Lama2	C	A	10: 26,993,068	E802*	probably null	Het
Lgi3	C	T	14: 70,531,029		probably benign	Het
Limch1	C	T	5: 67,036,084		probably benign	Het
Lipc	T	C	9: 70,803,781	N363S	probably damaging	Het
Lrit2	A	G	14: 37,068,045		probably null	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mug2	A	G	6: 122,040,648	Y448C	probably damaging	Het
Mybpc3	A	G	2: 91,124,494	E450G	probably damaging	Het
Myo5b	A	T	18: 74,742,171	T1549S	probably benign	Het
Naa15	T	C	3: 51,448,438		probably null	Het
Nckap1l	T	A	15: 103,455,028	C54S	probably benign	Het
Nlrp9b	A	G	7: 20,024,056	D406G	probably benign	Het
Nprl3	T	A	11: 32,239,784		probably benign	Het
Nvl	A	G	1: 181,120,391	V429A	probably benign	Het
Olfr114	A	T	17: 37,589,415	*313K	probably null	Het
Olfr54	G	A	11: 51,027,604	V201I	probably benign	Het
Olfr548-ps1	A	T	7: 102,542,731	Q265L	probably benign	Het
Olfr801	T	A	10: 129,669,598	Y307F	probably benign	Het
Opa1	A	T	16: 29,629,635	N912Y	probably benign	Het
Pcnx	T	C	12: 81,996,095	V2317A	possibly damaging	Het
Phf3	A	T	1: 30,805,443	N1478K	possibly damaging	Het
Phykpl	G	A	11: 51,586,653	D91N	probably benign	Het
Polr2b	T	A	5: 77,343,263	C984S	probably damaging	Het
Ppfibp1	A	G	6: 146,998,233	R141G	probably benign	Het
Ppm1d	G	A	11: 85,326,905	G20R	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppp2r5b	C	A	19: 6,228,431	V483F	probably benign	Het
Ppp4r4	T	A	12: 103,576,374	C132S	probably benign	Het
Prg2	A	G	2: 84,983,456		probably benign	Het
Prpf4b	G	A	13: 34,890,488		probably benign	Het
Rad54l2	T	C	9: 106,713,455	T491A	probably damaging	Het
Rnf213	G	T	11: 119,414,587	W548L	probably damaging	Het
Rusc2	G	T	4: 43,422,055	C825F	probably damaging	Het
Sema4b	A	G	7: 80,219,078		probably benign	Het
Sema6a	A	G	18: 47,290,177	V254A	probably damaging	Het
Slc13a3	A	G	2: 165,424,581	F346L	probably damaging	Het
Slc25a17	T	C	15: 81,337,959	D104G	probably damaging	Het
Specc1	A	T	11: 62,146,313	N707Y	possibly damaging	Het
Tex48	T	A	4: 63,608,459	E76V	probably damaging	Het
Tfr2	T	C	5: 137,577,465	V281A	probably benign	Het
Tgfb1i1	A	C	7: 128,249,494	Q238H	probably damaging	Het
Thoc6	G	A	17: 23,670,239	T122I	probably benign	Het
Tmtc1	G	A	6: 148,412,830		probably benign	Het
Tnfrsf8	T	C	4: 145,288,047	D264G	possibly damaging	Het
Trim43a	T	A	9: 88,584,160	I178N	probably damaging	Het
Ttn	G	C	2: 76,707,093	I26503M	possibly damaging	Het
Usp28	C	A	9: 49,039,023	D589E	probably benign	Het
Utp23	T	C	15: 51,882,511	S242P	probably damaging	Het
Vwa3a	A	G	7: 120,775,380	Y305C	probably benign	Het
Vwa5b1	C	A	4: 138,608,858	E142*	probably null	Het
Xrn2	A	T	2: 147,029,779	T374S	probably damaging	Het
Zfp735	A	T	11: 73,710,662	Q144L	probably benign	Het

Other mutations in Itga11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Itga11	APN	9	62769305	missense	possibly damaging	0.58
IGL01108:Itga11	APN	9	62757621	missense	probably benign
IGL01348:Itga11	APN	9	62744579	missense	possibly damaging	0.83
IGL01739:Itga11	APN	9	62774117	missense	probably benign	0.03
IGL01918:Itga11	APN	9	62772996	missense	probably benign	0.05
IGL02237:Itga11	APN	9	62755775	critical splice donor site	probably null
IGL02418:Itga11	APN	9	62744632	missense	probably benign	0.30
IGL02451:Itga11	APN	9	62735353	missense	probably damaging	1.00
sneezy	UTSW	9	62732109	missense	probably damaging	1.00
PIT4812001:Itga11	UTSW	9	62732193	missense	probably damaging	1.00
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0101:Itga11	UTSW	9	62744486	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62760302	missense	possibly damaging	0.85
R0212:Itga11	UTSW	9	62745969	missense	probably benign	0.22
R0310:Itga11	UTSW	9	62760346	missense	probably damaging	1.00
R0455:Itga11	UTSW	9	62696961	missense	probably damaging	1.00
R0558:Itga11	UTSW	9	62752288	missense	probably benign	0.01
R0607:Itga11	UTSW	9	62774371	missense	probably benign	0.00
R0924:Itga11	UTSW	9	62776674	missense	probably benign	0.14
R1085:Itga11	UTSW	9	62677970	missense	probably benign	0.03
R1477:Itga11	UTSW	9	62755211	missense	probably benign
R1647:Itga11	UTSW	9	62760370	missense	probably benign	0.01
R1831:Itga11	UTSW	9	62782018	missense	probably damaging	1.00
R1880:Itga11	UTSW	9	62677949	missense	probably benign	0.06
R1934:Itga11	UTSW	9	62744514	missense	probably damaging	1.00
R2025:Itga11	UTSW	9	62762811	missense	probably damaging	1.00
R2046:Itga11	UTSW	9	62727697	missense	probably damaging	1.00
R2145:Itga11	UTSW	9	62732204	splice site	probably benign
R2922:Itga11	UTSW	9	62768630	splice site	probably benign
R3011:Itga11	UTSW	9	62696980	missense	probably damaging	0.99
R3158:Itga11	UTSW	9	62769278	missense	probably benign	0.02
R3809:Itga11	UTSW	9	62771382	missense	probably benign
R3836:Itga11	UTSW	9	62769283	missense	probably benign	0.00
R4051:Itga11	UTSW	9	62755651	nonsense	probably null
R4190:Itga11	UTSW	9	62732109	missense	probably damaging	1.00
R4510:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4511:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4678:Itga11	UTSW	9	62735357	missense	probably damaging	0.98
R4706:Itga11	UTSW	9	62755296	missense	possibly damaging	0.64
R4713:Itga11	UTSW	9	62765788	missense	probably damaging	1.00
R4798:Itga11	UTSW	9	62776727	splice site	probably null
R4909:Itga11	UTSW	9	62755299	missense	probably damaging	1.00
R4915:Itga11	UTSW	9	62752248	nonsense	probably null
R4957:Itga11	UTSW	9	62767648	missense	probably benign	0.00
R4962:Itga11	UTSW	9	62761568	nonsense	probably null
R5081:Itga11	UTSW	9	62755196	missense	probably benign	0.13
R5265:Itga11	UTSW	9	62737412	missense	probably benign	0.05
R5308:Itga11	UTSW	9	62755769	missense	probably benign
R5398:Itga11	UTSW	9	62745923	missense	probably benign	0.21
R5717:Itga11	UTSW	9	62752249	missense	probably benign	0.26
R5885:Itga11	UTSW	9	62762850	missense	probably damaging	0.99
R5996:Itga11	UTSW	9	62755673	missense	probably benign	0.01
R6394:Itga11	UTSW	9	62735266	splice site	probably null
R6751:Itga11	UTSW	9	62768584	missense	probably benign	0.02
R7041:Itga11	UTSW	9	62752256	missense	probably damaging	1.00
R7264:Itga11	UTSW	9	62745908	missense	probably benign	0.02
R7509:Itga11	UTSW	9	62781940	missense	probably benign
R7601:Itga11	UTSW	9	62696926	missense	probably benign	0.18
R7615:Itga11	UTSW	9	62744018	missense	probably benign	0.00
R8263:Itga11	UTSW	9	62696980	missense	possibly damaging	0.86
R8285:Itga11	UTSW	9	62752258	missense	probably damaging	1.00
R8419:Itga11	UTSW	9	62755178	missense	possibly damaging	0.59
R8422:Itga11	UTSW	9	62767678	missense	probably benign	0.00
R8469:Itga11	UTSW	9	62771398	missense	probably benign	0.00
R8475:Itga11	UTSW	9	62744045	missense	probably damaging	1.00
R8871:Itga11	UTSW	9	62761541	nonsense	probably null
R8904:Itga11	UTSW	9	62757611	missense	probably benign
R8954:Itga11	UTSW	9	62769263	missense	possibly damaging	0.58
R8977:Itga11	UTSW	9	62755640	missense	probably damaging	0.98
R9011:Itga11	UTSW	9	62755627	missense	probably benign	0.43
R9038:Itga11	UTSW	9	62767757	missense	possibly damaging	0.90
R9089:Itga11	UTSW	9	62771380	missense	probably damaging	1.00
R9262:Itga11	UTSW	9	62752396	splice site	probably benign
R9327:Itga11	UTSW	9	62730752	missense	probably damaging	1.00
R9487:Itga11	UTSW	9	62762889	missense	probably benign	0.35
R9794:Itga11	UTSW	9	62755586	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTTGTATGGCCCAAGGACAACTC -3'
(R):5'- TTCATGGGACGATGCTTCCCAGTG -3'

Sequencing Primer
(F):5'- gcacacacgagacttccac -3'
(R):5'- GACACTCACCTGGATCTGG -3'

Posted On

2013-04-11