Incidental Mutation 'R1823:Prcp'
ID 206575
Institutional Source Beutler Lab
Gene Symbol Prcp
Ensembl Gene ENSMUSG00000061119
Gene Name prolylcarboxypeptidase (angiotensinase C)
Synonyms 2510048K03Rik, 2610104A14Rik
MMRRC Submission 039851-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1823 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 92524461-92583789 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92577883 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 349 (D349V)
Ref Sequence ENSEMBL: ENSMUSP00000146597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076052] [ENSMUST00000207594]
AlphaFold Q7TMR0
Predicted Effect possibly damaging
Transcript: ENSMUST00000076052
AA Change: D384V

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075429
Gene: ENSMUSG00000061119
AA Change: D384V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Peptidase_S37 20 211 1.4e-4 PFAM
Pfam:Peptidase_S28 53 475 3.4e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207594
AA Change: D349V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S28 family of serine exopeptidases. The encoded preproprotein is proteolytically processed to generate the mature lysosomal prolylcarboxypeptidase. This enzyme cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity is retained with some substrates at neutral pH. This enzyme has been shown to be an activator of the cell matrix-associated prekallikrein. The importance of angiotension II, one of the substrates of this enzyme, in regulating blood pressure and electrolyte balance suggests that this gene may be related to essential hypertension. A pseudogene of this gene has been identified on chromosome 2. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body length, weight, and fat pads with resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 G A 11: 7,111,312 (GRCm39) V868I probably benign Het
Ahnak G T 19: 8,982,269 (GRCm39) M1184I probably damaging Het
Akap11 T C 14: 78,748,928 (GRCm39) E1153G probably damaging Het
Amy1 T C 3: 113,356,376 (GRCm39) N260S probably null Het
Ankrd6 A G 4: 32,824,427 (GRCm39) L129P probably damaging Het
Aox1 A T 1: 58,351,518 (GRCm39) T702S probably benign Het
Apobec1 G T 6: 122,555,845 (GRCm39) T204K possibly damaging Het
Arhgef19 A G 4: 140,976,457 (GRCm39) R433G probably benign Het
Atf6b T A 17: 34,867,618 (GRCm39) H110Q possibly damaging Het
Btnl4 C T 17: 34,694,826 (GRCm39) probably null Het
Camsap2 T C 1: 136,201,521 (GRCm39) T662A possibly damaging Het
Cbs G A 17: 31,843,245 (GRCm39) H229Y probably damaging Het
Cct8 G A 16: 87,287,442 (GRCm39) R111* probably null Het
Cdc42bpb C T 12: 111,293,993 (GRCm39) A250T probably damaging Het
Chrd A G 16: 20,560,097 (GRCm39) probably benign Het
Ckap2l A G 2: 129,117,499 (GRCm39) F559L probably damaging Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
D630003M21Rik T C 2: 158,059,477 (GRCm39) Y141C probably damaging Het
Dbf4 T C 5: 8,447,539 (GRCm39) N557S probably benign Het
Dct T G 14: 118,273,935 (GRCm39) N324T probably benign Het
Dip2a A T 10: 76,114,336 (GRCm39) L999* probably null Het
Dock10 T A 1: 80,520,814 (GRCm39) probably null Het
Dync2li1 A T 17: 84,957,225 (GRCm39) D330V probably damaging Het
Eif4g3 T A 4: 137,907,802 (GRCm39) D1267E probably benign Het
Enc1 A G 13: 97,382,486 (GRCm39) E332G possibly damaging Het
Fat2 C T 11: 55,147,606 (GRCm39) V3879I probably benign Het
Fh1 A T 1: 175,444,114 (GRCm39) I117K probably damaging Het
Fkbp15 A G 4: 62,255,328 (GRCm39) L227P probably damaging Het
Fpr1 T A 17: 18,097,315 (GRCm39) M225L probably benign Het
Fras1 A T 5: 96,918,547 (GRCm39) I3528F probably damaging Het
Grm7 A G 6: 111,184,730 (GRCm39) T354A probably benign Het
Ift27 T A 15: 78,057,978 (GRCm39) I9F possibly damaging Het
Igf1r A G 7: 67,844,729 (GRCm39) D834G possibly damaging Het
Igsf9b T A 9: 27,243,028 (GRCm39) L738Q probably damaging Het
Itgam A T 7: 127,663,904 (GRCm39) T44S probably benign Het
Ivd T A 2: 118,692,515 (GRCm39) I5N probably benign Het
Jcad T C 18: 4,675,780 (GRCm39) S1181P probably damaging Het
Kctd18 A G 1: 57,995,524 (GRCm39) V251A probably benign Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo18a T C 11: 77,715,923 (GRCm39) probably benign Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myocd C A 11: 65,069,496 (GRCm39) M909I probably benign Het
Ndufv3 G A 17: 31,750,219 (GRCm39) R467Q probably damaging Het
Nkpd1 G A 7: 19,257,177 (GRCm39) V319M probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or1af1 T C 2: 37,110,344 (GRCm39) V281A probably damaging Het
Or1p1c C T 11: 74,161,043 (GRCm39) A276V probably damaging Het
Or2q1 G T 6: 42,795,202 (GRCm39) A266S possibly damaging Het
Or2t1 T A 14: 14,328,774 (GRCm38) L221Q probably damaging Het
Or4c111 A G 2: 88,843,722 (GRCm39) S229P probably benign Het
Or5b101 C A 19: 13,005,181 (GRCm39) V171L probably benign Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pcdhb9 A G 18: 37,535,871 (GRCm39) T622A probably benign Het
Pdpk1 A T 17: 24,317,150 (GRCm39) probably benign Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 G T 10: 3,853,658 (GRCm39) probably null Het
Plekhh2 A G 17: 84,882,617 (GRCm39) Y708C probably damaging Het
Pnp T C 14: 51,187,786 (GRCm39) F107L probably damaging Het
Postn T A 3: 54,292,708 (GRCm39) probably null Het
Prl3a1 A T 13: 27,454,177 (GRCm39) I52F probably damaging Het
Pym1 G A 10: 128,601,913 (GRCm39) probably benign Het
Rad9a A T 19: 4,247,241 (GRCm39) I248N probably damaging Het
Ror2 T G 13: 53,264,341 (GRCm39) E917A probably benign Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sema6d A G 2: 124,501,476 (GRCm39) probably null Het
Shisal1 T C 15: 84,290,669 (GRCm39) T213A probably benign Het
Slc4a2 C T 5: 24,632,618 (GRCm39) A12V probably damaging Het
Slco6b1 T G 1: 96,888,901 (GRCm39) noncoding transcript Het
Slf2 A T 19: 44,923,687 (GRCm39) H167L possibly damaging Het
Snx9 G T 17: 5,970,946 (GRCm39) G429V probably damaging Het
Sod3 G T 5: 52,525,504 (GRCm39) V68L probably benign Het
Spta1 T A 1: 174,074,115 (GRCm39) D2351E probably benign Het
Srpk3 G A X: 72,821,561 (GRCm39) R425Q possibly damaging Het
Tatdn1 C T 15: 58,788,005 (GRCm39) G171E probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Tnfsf9 A G 17: 57,412,738 (GRCm39) T103A probably benign Het
Tpm3-rs7 T C 14: 113,552,595 (GRCm39) L163P possibly damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Ucp1 C T 8: 84,020,661 (GRCm39) T157I probably damaging Het
Uspl1 T A 5: 149,151,224 (GRCm39) L794Q probably benign Het
Vmn1r5 T A 6: 56,962,580 (GRCm39) V85E probably damaging Het
Vmn1r58 A G 7: 5,413,405 (GRCm39) I275T possibly damaging Het
Vmn2r79 A G 7: 86,687,080 (GRCm39) I820M probably damaging Het
Wscd1 C A 11: 71,651,044 (GRCm39) P124T probably benign Het
Zfp780b A T 7: 27,662,525 (GRCm39) C677S possibly damaging Het
Other mutations in Prcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Prcp APN 7 92,582,307 (GRCm39) missense probably benign 0.00
IGL01124:Prcp APN 7 92,559,416 (GRCm39) missense probably benign 0.01
IGL01538:Prcp APN 7 92,559,421 (GRCm39) missense probably benign 0.09
IGL02005:Prcp APN 7 92,577,032 (GRCm39) missense probably benign 0.01
IGL02160:Prcp APN 7 92,566,969 (GRCm39) missense probably benign 0.02
IGL02548:Prcp APN 7 92,550,382 (GRCm39) missense probably damaging 0.98
R0140:Prcp UTSW 7 92,577,819 (GRCm39) missense probably damaging 1.00
R0480:Prcp UTSW 7 92,568,290 (GRCm39) missense probably damaging 1.00
R0989:Prcp UTSW 7 92,559,424 (GRCm39) missense probably benign 0.04
R1216:Prcp UTSW 7 92,566,954 (GRCm39) missense probably benign
R1596:Prcp UTSW 7 92,567,042 (GRCm39) intron probably benign
R2132:Prcp UTSW 7 92,550,488 (GRCm39) missense probably benign 0.01
R2206:Prcp UTSW 7 92,577,820 (GRCm39) missense probably damaging 1.00
R4761:Prcp UTSW 7 92,566,933 (GRCm39) splice site probably null
R5000:Prcp UTSW 7 92,568,368 (GRCm39) missense probably damaging 0.99
R5320:Prcp UTSW 7 92,577,843 (GRCm39) missense probably benign 0.01
R5969:Prcp UTSW 7 92,566,974 (GRCm39) missense probably benign 0.01
R6013:Prcp UTSW 7 92,576,976 (GRCm39) missense possibly damaging 0.72
R6298:Prcp UTSW 7 92,577,841 (GRCm39) missense probably damaging 1.00
R7733:Prcp UTSW 7 92,550,506 (GRCm39) missense probably damaging 1.00
R7852:Prcp UTSW 7 92,577,900 (GRCm39) missense probably benign 0.33
R8032:Prcp UTSW 7 92,577,906 (GRCm39) missense probably damaging 1.00
R8317:Prcp UTSW 7 92,524,598 (GRCm39) missense probably benign 0.05
R8869:Prcp UTSW 7 92,559,518 (GRCm39) missense possibly damaging 0.75
R9038:Prcp UTSW 7 92,567,017 (GRCm39) missense probably benign
R9185:Prcp UTSW 7 92,582,257 (GRCm39) missense probably benign
R9333:Prcp UTSW 7 92,577,894 (GRCm39) missense probably damaging 0.98
R9643:Prcp UTSW 7 92,524,598 (GRCm39) missense probably benign 0.00
R9725:Prcp UTSW 7 92,567,035 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAATGACCTTGAGCCTAGC -3'
(R):5'- GCACAGTGGAAAAGCATCAC -3'

Sequencing Primer
(F):5'- TTGAGCCTAGCTGAATGACC -3'
(R):5'- AATGTTACTTTAGTGCCTACCACC -3'
Posted On 2014-06-23