Mutagenetix > Incidental Mutation

Incidental Mutation 'R1823:Ucp1'

206580

Institutional Source

Beutler Lab

Gene Symbol

Ucp1

Ensembl Gene

ENSMUSG00000031710

Gene Name

uncoupling protein 1 (mitochondrial, proton carrier)

Synonyms

Slc25a7

MMRRC Submission

039851-MU

Accession Numbers

Ncbi RefSeq: NM_009463.3; MGI: 98894

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1823 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83290352-83298452 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83294032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 157 (T157I)

Ref Sequence

ENSEMBL: ENSMUSP00000034146 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034146]

AlphaFold

P12242

Predicted Effect

probably damaging
Transcript: ENSMUST00000034146
AA Change: T157I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: T157I

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	5.7e-20	PFAM
Pfam:Mito_carr	109	206	3.3e-20	PFAM
Pfam:Mito_carr	209	300	1.6e-18	PFAM

Meta Mutation Damage Score

0.2906

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.6%

Validation Efficiency

98% (87/89)

MGI Phenotype

Strain: 1857471
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	T	C	15: 84,406,468	T213A	probably benign	Het
Adcy1	G	A	11: 7,161,312	V868I	probably benign	Het
Ahnak	G	T	19: 9,004,905	M1184I	probably damaging	Het
Akap11	T	C	14: 78,511,488	E1153G	probably damaging	Het
Amy1	T	C	3: 113,562,727	N260S	probably null	Het
Ankrd6	A	G	4: 32,824,427	L129P	probably damaging	Het
Aox2	A	T	1: 58,312,359	T702S	probably benign	Het
Apobec1	G	T	6: 122,578,886	T204K	possibly damaging	Het
Arhgef19	A	G	4: 141,249,146	R433G	probably benign	Het
Atf6b	T	A	17: 34,648,644	H110Q	possibly damaging	Het
Btnl4	C	T	17: 34,475,852		probably null	Het
Camsap2	T	C	1: 136,273,783	T662A	possibly damaging	Het
Cbs	G	A	17: 31,624,271	H229Y	probably damaging	Het
Cct8	G	A	16: 87,490,554	R111*	probably null	Het
Cdc42bpb	C	T	12: 111,327,559	A250T	probably damaging	Het
Chrd	A	G	16: 20,741,347		probably benign	Het
Ckap2l	A	G	2: 129,275,579	F559L	probably damaging	Het
D630003M21Rik	T	C	2: 158,217,557	Y141C	probably damaging	Het
Dbf4	T	C	5: 8,397,539	N557S	probably benign	Het
Dct	T	G	14: 118,036,523	N324T	probably benign	Het
Dip2a	A	T	10: 76,278,502	L999*	probably null	Het
Dock10	T	A	1: 80,543,097		probably null	Het
Dync2li1	A	T	17: 84,649,797	D330V	probably damaging	Het
Eif4g3	T	A	4: 138,180,491	D1267E	probably benign	Het
Enc1	A	G	13: 97,245,978	E332G	possibly damaging	Het
Fat2	C	T	11: 55,256,780	V3879I	probably benign	Het
Fh1	A	T	1: 175,616,548	I117K	probably damaging	Het
Fkbp15	A	G	4: 62,337,091	L227P	probably damaging	Het
Fpr1	T	A	17: 17,877,053	M225L	probably benign	Het
Fras1	A	T	5: 96,770,688	I3528F	probably damaging	Het
Grm7	A	G	6: 111,207,769	T354A	probably benign	Het
Ift27	T	A	15: 78,173,778	I9F	possibly damaging	Het
Igf1r	A	G	7: 68,194,981	D834G	possibly damaging	Het
Igsf9b	T	A	9: 27,331,732	L738Q	probably damaging	Het
Itgam	A	T	7: 128,064,732	T44S	probably benign	Het
Ivd	T	A	2: 118,862,034	I5N	probably benign	Het
Jcad	T	C	18: 4,675,780	S1181P	probably damaging	Het
Kctd18	A	G	1: 57,956,365	V251A	probably benign	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo18a	T	C	11: 77,825,097		probably benign	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myocd	C	A	11: 65,178,670	M909I	probably benign	Het
Ndufv3	G	A	17: 31,531,245	R467Q	probably damaging	Het
Nkpd1	G	A	7: 19,523,252	V319M	probably damaging	Het
Olfr1216	A	G	2: 89,013,378	S229P	probably benign	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Olfr1453	C	A	19: 13,027,817	V171L	probably benign	Het
Olfr31	T	A	14: 14,328,774	L221Q	probably damaging	Het
Olfr366	T	C	2: 37,220,332	V281A	probably damaging	Het
Olfr406	C	T	11: 74,270,217	A276V	probably damaging	Het
Olfr450	G	T	6: 42,818,268	A266S	possibly damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pcdhb9	A	G	18: 37,402,818	T622A	probably benign	Het
Pdpk1	A	T	17: 24,098,176		probably benign	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	G	T	10: 3,903,658		probably null	Het
Plekhh2	A	G	17: 84,575,189	Y708C	probably damaging	Het
Pnp	T	C	14: 50,950,329	F107L	probably damaging	Het
Postn	T	A	3: 54,385,287		probably null	Het
Prcp	A	T	7: 92,928,675	D349V	probably damaging	Het
Prl3a1	A	T	13: 27,270,194	I52F	probably damaging	Het
Pym1	G	A	10: 128,766,044		probably benign	Het
Rad9a	A	T	19: 4,197,242	I248N	probably damaging	Het
Ror2	T	G	13: 53,110,305	E917A	probably benign	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sema6d	A	G	2: 124,659,556		probably null	Het
Slc4a2	C	T	5: 24,427,620	A12V	probably damaging	Het
Slco6b1	T	G	1: 96,961,176		noncoding transcript	Het
Slf2	A	T	19: 44,935,248	H167L	possibly damaging	Het
Snx9	G	T	17: 5,920,671	G429V	probably damaging	Het
Sod3	G	T	5: 52,368,162	V68L	probably benign	Het
Spta1	T	A	1: 174,246,549	D2351E	probably benign	Het
Srpk3	G	A	X: 73,777,955	R425Q	possibly damaging	Het
Tatdn1	C	T	15: 58,916,156	G171E	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnfsf9	A	G	17: 57,105,738	T103A	probably benign	Het
Tpm3-rs7	T	C	14: 113,315,163	L163P	possibly damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Uspl1	T	A	5: 149,214,414	L794Q	probably benign	Het
Vmn1r5	T	A	6: 56,985,595	V85E	probably damaging	Het
Vmn1r58	A	G	7: 5,410,406	I275T	possibly damaging	Het
Vmn2r79	A	G	7: 87,037,872	I820M	probably damaging	Het
Wscd1	C	A	11: 71,760,218	P124T	probably benign	Het
Zfp780b	A	T	7: 27,963,100	C677S	possibly damaging	Het

Other mutations in Ucp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4585001:Ucp1	UTSW	8	83293948	missense	probably damaging	1.00
R0050:Ucp1	UTSW	8	83294228	missense	probably damaging	1.00
R0055:Ucp1	UTSW	8	83290604	nonsense	probably null
R0055:Ucp1	UTSW	8	83290604	nonsense	probably null
R0505:Ucp1	UTSW	8	83295307	missense	possibly damaging	0.78
R0590:Ucp1	UTSW	8	83291603	splice site	probably benign
R0681:Ucp1	UTSW	8	83295307	missense	possibly damaging	0.78
R0731:Ucp1	UTSW	8	83297847	splice site	probably benign
R1606:Ucp1	UTSW	8	83295304	missense	probably damaging	1.00
R1722:Ucp1	UTSW	8	83290688	missense	probably benign	0.25
R1809:Ucp1	UTSW	8	83297867	missense	probably damaging	0.99
R3809:Ucp1	UTSW	8	83290641	missense	probably damaging	0.99
R4085:Ucp1	UTSW	8	83293951	missense	probably benign	0.43
R4673:Ucp1	UTSW	8	83295247	missense	probably damaging	1.00
R4998:Ucp1	UTSW	8	83297855	critical splice acceptor site	probably null
R5163:Ucp1	UTSW	8	83294203	missense	possibly damaging	0.95
R5421:Ucp1	UTSW	8	83290691	missense	probably benign	0.12
R5790:Ucp1	UTSW	8	83297891	missense	possibly damaging	0.54
R5994:Ucp1	UTSW	8	83293938	missense	possibly damaging	0.92
R6574:Ucp1	UTSW	8	83294089	critical splice donor site	probably null
R6732:Ucp1	UTSW	8	83291477	missense	probably benign	0.08
R7282:Ucp1	UTSW	8	83293902	missense	probably benign	0.03
R7343:Ucp1	UTSW	8	83295252	missense	probably damaging	0.99
R7878:Ucp1	UTSW	8	83297892	missense	probably benign	0.19
R8008:Ucp1	UTSW	8	83294011	missense	probably benign	0.32
R8365:Ucp1	UTSW	8	83293999	missense	probably damaging	0.97
R8899:Ucp1	UTSW	8	83290587	missense	probably benign	0.35
R9186:Ucp1	UTSW	8	83290643	nonsense	probably null
R9499:Ucp1	UTSW	8	83297880	missense	probably damaging	1.00
R9551:Ucp1	UTSW	8	83297880	missense	probably damaging	1.00
R9552:Ucp1	UTSW	8	83297880	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGGTAGGGGCAGGCTCTT -3'
(R):5'- ACCAGCTCTGTACAATTGATGATGA -3'

Sequencing Primer
(F):5'- AGGCTCTTGGTTTTTCTTTTCTTAAC -3'
(R):5'- ACATTTCTCATTAGATTAGGGGTCG -3'

Posted On

2014-06-23