Incidental Mutation 'R1823:Adcy1'
ID 206585
Institutional Source Beutler Lab
Gene Symbol Adcy1
Ensembl Gene ENSMUSG00000020431
Gene Name adenylate cyclase 1
Synonyms AC1, I-AC, D11Bwg1392e
MMRRC Submission 039851-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1823 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 7013489-7128506 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 7111312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 868 (V868I)
Ref Sequence ENSEMBL: ENSMUSP00000020706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020706]
AlphaFold O88444
Predicted Effect probably benign
Transcript: ENSMUST00000020706
AA Change: V868I

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020706
Gene: ENSMUSG00000020431
AA Change: V868I

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
low complexity region 58 90 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
CYCc 257 455 2.05e-80 SMART
transmembrane domain 608 630 N/A INTRINSIC
transmembrane domain 634 656 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
CYCc 827 1038 1.71e-50 SMART
low complexity region 1090 1104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135398
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the of adenylate cyclase gene family that is primarily expressed in the brain. This protein is regulated by calcium/calmodulin concentration and may be involved in brain development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for an insertional or null mutation fail to develop normal patterned distribution of neurons in the brain and display behavioral and learning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G T 19: 8,982,269 (GRCm39) M1184I probably damaging Het
Akap11 T C 14: 78,748,928 (GRCm39) E1153G probably damaging Het
Amy1 T C 3: 113,356,376 (GRCm39) N260S probably null Het
Ankrd6 A G 4: 32,824,427 (GRCm39) L129P probably damaging Het
Aox1 A T 1: 58,351,518 (GRCm39) T702S probably benign Het
Apobec1 G T 6: 122,555,845 (GRCm39) T204K possibly damaging Het
Arhgef19 A G 4: 140,976,457 (GRCm39) R433G probably benign Het
Atf6b T A 17: 34,867,618 (GRCm39) H110Q possibly damaging Het
Btnl4 C T 17: 34,694,826 (GRCm39) probably null Het
Camsap2 T C 1: 136,201,521 (GRCm39) T662A possibly damaging Het
Cbs G A 17: 31,843,245 (GRCm39) H229Y probably damaging Het
Cct8 G A 16: 87,287,442 (GRCm39) R111* probably null Het
Cdc42bpb C T 12: 111,293,993 (GRCm39) A250T probably damaging Het
Chrd A G 16: 20,560,097 (GRCm39) probably benign Het
Ckap2l A G 2: 129,117,499 (GRCm39) F559L probably damaging Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
D630003M21Rik T C 2: 158,059,477 (GRCm39) Y141C probably damaging Het
Dbf4 T C 5: 8,447,539 (GRCm39) N557S probably benign Het
Dct T G 14: 118,273,935 (GRCm39) N324T probably benign Het
Dip2a A T 10: 76,114,336 (GRCm39) L999* probably null Het
Dock10 T A 1: 80,520,814 (GRCm39) probably null Het
Dync2li1 A T 17: 84,957,225 (GRCm39) D330V probably damaging Het
Eif4g3 T A 4: 137,907,802 (GRCm39) D1267E probably benign Het
Enc1 A G 13: 97,382,486 (GRCm39) E332G possibly damaging Het
Fat2 C T 11: 55,147,606 (GRCm39) V3879I probably benign Het
Fh1 A T 1: 175,444,114 (GRCm39) I117K probably damaging Het
Fkbp15 A G 4: 62,255,328 (GRCm39) L227P probably damaging Het
Fpr1 T A 17: 18,097,315 (GRCm39) M225L probably benign Het
Fras1 A T 5: 96,918,547 (GRCm39) I3528F probably damaging Het
Grm7 A G 6: 111,184,730 (GRCm39) T354A probably benign Het
Ift27 T A 15: 78,057,978 (GRCm39) I9F possibly damaging Het
Igf1r A G 7: 67,844,729 (GRCm39) D834G possibly damaging Het
Igsf9b T A 9: 27,243,028 (GRCm39) L738Q probably damaging Het
Itgam A T 7: 127,663,904 (GRCm39) T44S probably benign Het
Ivd T A 2: 118,692,515 (GRCm39) I5N probably benign Het
Jcad T C 18: 4,675,780 (GRCm39) S1181P probably damaging Het
Kctd18 A G 1: 57,995,524 (GRCm39) V251A probably benign Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo18a T C 11: 77,715,923 (GRCm39) probably benign Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myocd C A 11: 65,069,496 (GRCm39) M909I probably benign Het
Ndufv3 G A 17: 31,750,219 (GRCm39) R467Q probably damaging Het
Nkpd1 G A 7: 19,257,177 (GRCm39) V319M probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or1af1 T C 2: 37,110,344 (GRCm39) V281A probably damaging Het
Or1p1c C T 11: 74,161,043 (GRCm39) A276V probably damaging Het
Or2q1 G T 6: 42,795,202 (GRCm39) A266S possibly damaging Het
Or2t1 T A 14: 14,328,774 (GRCm38) L221Q probably damaging Het
Or4c111 A G 2: 88,843,722 (GRCm39) S229P probably benign Het
Or5b101 C A 19: 13,005,181 (GRCm39) V171L probably benign Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pcdhb9 A G 18: 37,535,871 (GRCm39) T622A probably benign Het
Pdpk1 A T 17: 24,317,150 (GRCm39) probably benign Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 G T 10: 3,853,658 (GRCm39) probably null Het
Plekhh2 A G 17: 84,882,617 (GRCm39) Y708C probably damaging Het
Pnp T C 14: 51,187,786 (GRCm39) F107L probably damaging Het
Postn T A 3: 54,292,708 (GRCm39) probably null Het
Prcp A T 7: 92,577,883 (GRCm39) D349V probably damaging Het
Prl3a1 A T 13: 27,454,177 (GRCm39) I52F probably damaging Het
Pym1 G A 10: 128,601,913 (GRCm39) probably benign Het
Rad9a A T 19: 4,247,241 (GRCm39) I248N probably damaging Het
Ror2 T G 13: 53,264,341 (GRCm39) E917A probably benign Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sema6d A G 2: 124,501,476 (GRCm39) probably null Het
Shisal1 T C 15: 84,290,669 (GRCm39) T213A probably benign Het
Slc4a2 C T 5: 24,632,618 (GRCm39) A12V probably damaging Het
Slco6b1 T G 1: 96,888,901 (GRCm39) noncoding transcript Het
Slf2 A T 19: 44,923,687 (GRCm39) H167L possibly damaging Het
Snx9 G T 17: 5,970,946 (GRCm39) G429V probably damaging Het
Sod3 G T 5: 52,525,504 (GRCm39) V68L probably benign Het
Spta1 T A 1: 174,074,115 (GRCm39) D2351E probably benign Het
Srpk3 G A X: 72,821,561 (GRCm39) R425Q possibly damaging Het
Tatdn1 C T 15: 58,788,005 (GRCm39) G171E probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Tnfsf9 A G 17: 57,412,738 (GRCm39) T103A probably benign Het
Tpm3-rs7 T C 14: 113,552,595 (GRCm39) L163P possibly damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Ucp1 C T 8: 84,020,661 (GRCm39) T157I probably damaging Het
Uspl1 T A 5: 149,151,224 (GRCm39) L794Q probably benign Het
Vmn1r5 T A 6: 56,962,580 (GRCm39) V85E probably damaging Het
Vmn1r58 A G 7: 5,413,405 (GRCm39) I275T possibly damaging Het
Vmn2r79 A G 7: 86,687,080 (GRCm39) I820M probably damaging Het
Wscd1 C A 11: 71,651,044 (GRCm39) P124T probably benign Het
Zfp780b A T 7: 27,662,525 (GRCm39) C677S possibly damaging Het
Other mutations in Adcy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Adcy1 APN 11 7,087,385 (GRCm39) missense probably damaging 0.99
IGL01325:Adcy1 APN 11 7,014,102 (GRCm39) missense possibly damaging 0.58
IGL01531:Adcy1 APN 11 7,119,414 (GRCm39) missense possibly damaging 0.95
IGL01585:Adcy1 APN 11 7,117,143 (GRCm39) missense probably damaging 1.00
IGL01932:Adcy1 APN 11 7,050,565 (GRCm39) splice site probably benign
IGL01945:Adcy1 APN 11 7,111,891 (GRCm39) missense probably damaging 1.00
IGL02532:Adcy1 APN 11 7,094,737 (GRCm39) missense probably benign 0.26
IGL02649:Adcy1 APN 11 7,117,156 (GRCm39) missense probably damaging 1.00
IGL02658:Adcy1 APN 11 7,088,279 (GRCm39) splice site probably benign
IGL02813:Adcy1 APN 11 7,096,591 (GRCm39) missense possibly damaging 0.83
IGL02931:Adcy1 APN 11 7,029,012 (GRCm39) missense probably benign 0.19
IGL03116:Adcy1 APN 11 7,100,071 (GRCm39) missense probably benign
IGL03119:Adcy1 APN 11 7,059,051 (GRCm39) missense probably damaging 1.00
IGL03214:Adcy1 APN 11 7,117,054 (GRCm39) splice site probably benign
PIT4431001:Adcy1 UTSW 11 7,014,089 (GRCm39) missense possibly damaging 0.93
PIT4520001:Adcy1 UTSW 11 7,117,133 (GRCm39) missense probably damaging 1.00
R0032:Adcy1 UTSW 11 7,094,729 (GRCm39) missense possibly damaging 0.93
R0032:Adcy1 UTSW 11 7,094,729 (GRCm39) missense possibly damaging 0.93
R0080:Adcy1 UTSW 11 7,099,497 (GRCm39) splice site probably benign
R0082:Adcy1 UTSW 11 7,099,497 (GRCm39) splice site probably benign
R0238:Adcy1 UTSW 11 7,089,162 (GRCm39) missense possibly damaging 0.80
R0238:Adcy1 UTSW 11 7,089,162 (GRCm39) missense possibly damaging 0.80
R0312:Adcy1 UTSW 11 7,099,538 (GRCm39) missense probably benign 0.08
R0569:Adcy1 UTSW 11 7,096,514 (GRCm39) missense probably benign 0.34
R1055:Adcy1 UTSW 11 7,059,075 (GRCm39) missense probably damaging 1.00
R1144:Adcy1 UTSW 11 7,087,400 (GRCm39) missense probably damaging 1.00
R1179:Adcy1 UTSW 11 7,117,054 (GRCm39) splice site probably null
R1245:Adcy1 UTSW 11 7,119,410 (GRCm39) splice site probably benign
R1467:Adcy1 UTSW 11 7,088,396 (GRCm39) missense probably damaging 0.97
R1467:Adcy1 UTSW 11 7,088,396 (GRCm39) missense probably damaging 0.97
R1953:Adcy1 UTSW 11 7,028,991 (GRCm39) missense probably benign 0.01
R1957:Adcy1 UTSW 11 7,111,945 (GRCm39) missense probably benign 0.00
R2029:Adcy1 UTSW 11 7,089,142 (GRCm39) missense probably benign 0.10
R2051:Adcy1 UTSW 11 7,111,885 (GRCm39) nonsense probably null
R2483:Adcy1 UTSW 11 7,080,348 (GRCm39) missense probably benign 0.01
R3108:Adcy1 UTSW 11 7,119,453 (GRCm39) missense probably damaging 1.00
R3623:Adcy1 UTSW 11 7,080,348 (GRCm39) missense probably benign 0.01
R3624:Adcy1 UTSW 11 7,080,348 (GRCm39) missense probably benign 0.01
R4082:Adcy1 UTSW 11 7,014,117 (GRCm39) missense probably damaging 1.00
R4159:Adcy1 UTSW 11 7,013,889 (GRCm39) missense probably damaging 1.00
R4470:Adcy1 UTSW 11 7,094,804 (GRCm39) missense probably benign 0.17
R4472:Adcy1 UTSW 11 7,080,369 (GRCm39) missense probably damaging 1.00
R4951:Adcy1 UTSW 11 7,088,336 (GRCm39) missense possibly damaging 0.83
R4997:Adcy1 UTSW 11 7,111,298 (GRCm39) missense probably benign 0.25
R5237:Adcy1 UTSW 11 7,099,553 (GRCm39) missense probably benign 0.00
R5288:Adcy1 UTSW 11 7,111,351 (GRCm39) missense probably benign 0.01
R5304:Adcy1 UTSW 11 7,014,198 (GRCm39) missense probably benign 0.00
R5341:Adcy1 UTSW 11 7,080,375 (GRCm39) missense probably damaging 0.99
R5379:Adcy1 UTSW 11 7,096,532 (GRCm39) missense probably damaging 1.00
R5592:Adcy1 UTSW 11 7,089,088 (GRCm39) nonsense probably null
R5677:Adcy1 UTSW 11 7,111,914 (GRCm39) missense probably damaging 1.00
R5680:Adcy1 UTSW 11 7,059,020 (GRCm39) missense probably damaging 1.00
R5753:Adcy1 UTSW 11 7,080,300 (GRCm39) missense probably damaging 1.00
R5888:Adcy1 UTSW 11 7,089,095 (GRCm39) missense possibly damaging 0.66
R5943:Adcy1 UTSW 11 7,111,337 (GRCm39) missense probably damaging 1.00
R6435:Adcy1 UTSW 11 7,111,367 (GRCm39) missense possibly damaging 0.60
R6931:Adcy1 UTSW 11 7,100,884 (GRCm39) missense possibly damaging 0.81
R6998:Adcy1 UTSW 11 7,029,026 (GRCm39) missense probably damaging 1.00
R7368:Adcy1 UTSW 11 7,094,765 (GRCm39) missense probably damaging 1.00
R7378:Adcy1 UTSW 11 7,119,543 (GRCm39) missense possibly damaging 0.56
R7393:Adcy1 UTSW 11 7,087,381 (GRCm39) missense probably damaging 1.00
R7500:Adcy1 UTSW 11 7,094,762 (GRCm39) missense probably damaging 1.00
R7529:Adcy1 UTSW 11 7,089,157 (GRCm39) missense probably damaging 0.98
R8681:Adcy1 UTSW 11 7,111,328 (GRCm39) missense probably damaging 1.00
R8682:Adcy1 UTSW 11 7,111,328 (GRCm39) missense probably damaging 1.00
R8683:Adcy1 UTSW 11 7,111,328 (GRCm39) missense probably damaging 1.00
R8831:Adcy1 UTSW 11 7,111,362 (GRCm39) missense probably benign 0.02
R8859:Adcy1 UTSW 11 7,111,877 (GRCm39) missense probably benign 0.06
R8894:Adcy1 UTSW 11 7,087,375 (GRCm39) missense probably damaging 0.97
R8904:Adcy1 UTSW 11 7,059,075 (GRCm39) missense probably damaging 1.00
R8970:Adcy1 UTSW 11 7,099,983 (GRCm39) missense probably benign 0.00
R9037:Adcy1 UTSW 11 7,087,325 (GRCm39) missense possibly damaging 0.78
R9172:Adcy1 UTSW 11 7,110,317 (GRCm39) missense probably damaging 0.97
R9303:Adcy1 UTSW 11 7,094,766 (GRCm39) missense probably damaging 1.00
R9448:Adcy1 UTSW 11 7,099,575 (GRCm39) missense possibly damaging 0.94
R9694:Adcy1 UTSW 11 7,094,774 (GRCm39) missense probably damaging 1.00
R9763:Adcy1 UTSW 11 7,014,126 (GRCm39) missense probably damaging 1.00
X0027:Adcy1 UTSW 11 7,111,930 (GRCm39) missense possibly damaging 0.47
Z1088:Adcy1 UTSW 11 7,100,019 (GRCm39) missense probably benign 0.19
Z1176:Adcy1 UTSW 11 7,100,857 (GRCm39) missense probably damaging 0.96
Z1176:Adcy1 UTSW 11 7,099,536 (GRCm39) missense probably damaging 0.99
Z1176:Adcy1 UTSW 11 7,059,098 (GRCm39) missense probably damaging 1.00
Z1176:Adcy1 UTSW 11 7,100,858 (GRCm39) missense possibly damaging 0.62
Z1177:Adcy1 UTSW 11 7,094,802 (GRCm39) missense probably damaging 1.00
Z1177:Adcy1 UTSW 11 7,050,642 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTACCTGTGGAACCAACTGG -3'
(R):5'- AAGATGCTCTGTCCTGGACC -3'

Sequencing Primer
(F):5'- GAACCAACTGGGCCCCTATG -3'
(R):5'- TGGACCCTACTGGAGACACAG -3'
Posted On 2014-06-23