Incidental Mutation 'R1823:Ror2'
ID 206593
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Name receptor tyrosine kinase-like orphan receptor 2
Synonyms Ntrkr2
MMRRC Submission 039851-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1823 (G1)
Quality Score 82
Status Validated
Chromosome 13
Chromosomal Location 53263353-53440160 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 53264341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 917 (E917A)
Ref Sequence ENSEMBL: ENSMUSP00000021918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021918
AA Change: E917A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: E917A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130235
AA Change: E905A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: E905A

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 G A 11: 7,111,312 (GRCm39) V868I probably benign Het
Ahnak G T 19: 8,982,269 (GRCm39) M1184I probably damaging Het
Akap11 T C 14: 78,748,928 (GRCm39) E1153G probably damaging Het
Amy1 T C 3: 113,356,376 (GRCm39) N260S probably null Het
Ankrd6 A G 4: 32,824,427 (GRCm39) L129P probably damaging Het
Aox1 A T 1: 58,351,518 (GRCm39) T702S probably benign Het
Apobec1 G T 6: 122,555,845 (GRCm39) T204K possibly damaging Het
Arhgef19 A G 4: 140,976,457 (GRCm39) R433G probably benign Het
Atf6b T A 17: 34,867,618 (GRCm39) H110Q possibly damaging Het
Btnl4 C T 17: 34,694,826 (GRCm39) probably null Het
Camsap2 T C 1: 136,201,521 (GRCm39) T662A possibly damaging Het
Cbs G A 17: 31,843,245 (GRCm39) H229Y probably damaging Het
Cct8 G A 16: 87,287,442 (GRCm39) R111* probably null Het
Cdc42bpb C T 12: 111,293,993 (GRCm39) A250T probably damaging Het
Chrd A G 16: 20,560,097 (GRCm39) probably benign Het
Ckap2l A G 2: 129,117,499 (GRCm39) F559L probably damaging Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
D630003M21Rik T C 2: 158,059,477 (GRCm39) Y141C probably damaging Het
Dbf4 T C 5: 8,447,539 (GRCm39) N557S probably benign Het
Dct T G 14: 118,273,935 (GRCm39) N324T probably benign Het
Dip2a A T 10: 76,114,336 (GRCm39) L999* probably null Het
Dock10 T A 1: 80,520,814 (GRCm39) probably null Het
Dync2li1 A T 17: 84,957,225 (GRCm39) D330V probably damaging Het
Eif4g3 T A 4: 137,907,802 (GRCm39) D1267E probably benign Het
Enc1 A G 13: 97,382,486 (GRCm39) E332G possibly damaging Het
Fat2 C T 11: 55,147,606 (GRCm39) V3879I probably benign Het
Fh1 A T 1: 175,444,114 (GRCm39) I117K probably damaging Het
Fkbp15 A G 4: 62,255,328 (GRCm39) L227P probably damaging Het
Fpr1 T A 17: 18,097,315 (GRCm39) M225L probably benign Het
Fras1 A T 5: 96,918,547 (GRCm39) I3528F probably damaging Het
Grm7 A G 6: 111,184,730 (GRCm39) T354A probably benign Het
Ift27 T A 15: 78,057,978 (GRCm39) I9F possibly damaging Het
Igf1r A G 7: 67,844,729 (GRCm39) D834G possibly damaging Het
Igsf9b T A 9: 27,243,028 (GRCm39) L738Q probably damaging Het
Itgam A T 7: 127,663,904 (GRCm39) T44S probably benign Het
Ivd T A 2: 118,692,515 (GRCm39) I5N probably benign Het
Jcad T C 18: 4,675,780 (GRCm39) S1181P probably damaging Het
Kctd18 A G 1: 57,995,524 (GRCm39) V251A probably benign Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo18a T C 11: 77,715,923 (GRCm39) probably benign Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myocd C A 11: 65,069,496 (GRCm39) M909I probably benign Het
Ndufv3 G A 17: 31,750,219 (GRCm39) R467Q probably damaging Het
Nkpd1 G A 7: 19,257,177 (GRCm39) V319M probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or1af1 T C 2: 37,110,344 (GRCm39) V281A probably damaging Het
Or1p1c C T 11: 74,161,043 (GRCm39) A276V probably damaging Het
Or2q1 G T 6: 42,795,202 (GRCm39) A266S possibly damaging Het
Or2t1 T A 14: 14,328,774 (GRCm38) L221Q probably damaging Het
Or4c111 A G 2: 88,843,722 (GRCm39) S229P probably benign Het
Or5b101 C A 19: 13,005,181 (GRCm39) V171L probably benign Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pcdhb9 A G 18: 37,535,871 (GRCm39) T622A probably benign Het
Pdpk1 A T 17: 24,317,150 (GRCm39) probably benign Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 G T 10: 3,853,658 (GRCm39) probably null Het
Plekhh2 A G 17: 84,882,617 (GRCm39) Y708C probably damaging Het
Pnp T C 14: 51,187,786 (GRCm39) F107L probably damaging Het
Postn T A 3: 54,292,708 (GRCm39) probably null Het
Prcp A T 7: 92,577,883 (GRCm39) D349V probably damaging Het
Prl3a1 A T 13: 27,454,177 (GRCm39) I52F probably damaging Het
Pym1 G A 10: 128,601,913 (GRCm39) probably benign Het
Rad9a A T 19: 4,247,241 (GRCm39) I248N probably damaging Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sema6d A G 2: 124,501,476 (GRCm39) probably null Het
Shisal1 T C 15: 84,290,669 (GRCm39) T213A probably benign Het
Slc4a2 C T 5: 24,632,618 (GRCm39) A12V probably damaging Het
Slco6b1 T G 1: 96,888,901 (GRCm39) noncoding transcript Het
Slf2 A T 19: 44,923,687 (GRCm39) H167L possibly damaging Het
Snx9 G T 17: 5,970,946 (GRCm39) G429V probably damaging Het
Sod3 G T 5: 52,525,504 (GRCm39) V68L probably benign Het
Spta1 T A 1: 174,074,115 (GRCm39) D2351E probably benign Het
Srpk3 G A X: 72,821,561 (GRCm39) R425Q possibly damaging Het
Tatdn1 C T 15: 58,788,005 (GRCm39) G171E probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Tnfsf9 A G 17: 57,412,738 (GRCm39) T103A probably benign Het
Tpm3-rs7 T C 14: 113,552,595 (GRCm39) L163P possibly damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Ucp1 C T 8: 84,020,661 (GRCm39) T157I probably damaging Het
Uspl1 T A 5: 149,151,224 (GRCm39) L794Q probably benign Het
Vmn1r5 T A 6: 56,962,580 (GRCm39) V85E probably damaging Het
Vmn1r58 A G 7: 5,413,405 (GRCm39) I275T possibly damaging Het
Vmn2r79 A G 7: 86,687,080 (GRCm39) I820M probably damaging Het
Wscd1 C A 11: 71,651,044 (GRCm39) P124T probably benign Het
Zfp780b A T 7: 27,662,525 (GRCm39) C677S possibly damaging Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53,267,118 (GRCm39) missense probably benign 0.01
IGL01523:Ror2 APN 13 53,272,999 (GRCm39) missense probably benign 0.02
IGL01599:Ror2 APN 13 53,265,653 (GRCm39) missense probably damaging 1.00
IGL01669:Ror2 APN 13 53,265,124 (GRCm39) missense probably damaging 1.00
IGL02016:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02138:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02139:Ror2 APN 13 53,265,200 (GRCm39) missense probably damaging 1.00
IGL02172:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02173:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02176:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02177:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02178:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02179:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02182:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02189:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02190:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02203:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02230:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02231:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02234:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02423:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02424:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02478:Ror2 APN 13 53,275,703 (GRCm39) missense probably damaging 1.00
IGL02479:Ror2 APN 13 53,285,968 (GRCm39) missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53,272,876 (GRCm39) missense probably damaging 1.00
IGL02554:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02618:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02619:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02622:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
IGL02623:Ror2 APN 13 53,264,764 (GRCm39) missense probably damaging 1.00
lavage UTSW 13 53,273,018 (GRCm39) missense probably damaging 1.00
tendrils UTSW 13 53,265,487 (GRCm39) missense probably damaging 0.96
willowy UTSW 13 53,285,955 (GRCm39) missense probably damaging 1.00
R0076:Ror2 UTSW 13 53,267,110 (GRCm39) missense probably benign 0.02
R0375:Ror2 UTSW 13 53,286,040 (GRCm39) missense probably damaging 1.00
R0826:Ror2 UTSW 13 53,267,253 (GRCm39) missense probably damaging 1.00
R1895:Ror2 UTSW 13 53,285,885 (GRCm39) missense probably damaging 1.00
R1946:Ror2 UTSW 13 53,285,885 (GRCm39) missense probably damaging 1.00
R1983:Ror2 UTSW 13 53,264,444 (GRCm39) missense probably benign 0.01
R2031:Ror2 UTSW 13 53,271,366 (GRCm39) missense probably benign 0.01
R2197:Ror2 UTSW 13 53,439,816 (GRCm39) critical splice donor site probably null
R2246:Ror2 UTSW 13 53,265,638 (GRCm39) missense probably damaging 1.00
R2405:Ror2 UTSW 13 53,284,980 (GRCm39) missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53,284,980 (GRCm39) missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53,286,031 (GRCm39) missense probably benign 0.01
R3156:Ror2 UTSW 13 53,271,400 (GRCm39) missense probably damaging 0.98
R4198:Ror2 UTSW 13 53,264,680 (GRCm39) missense probably benign 0.08
R4408:Ror2 UTSW 13 53,272,997 (GRCm39) missense probably damaging 1.00
R4469:Ror2 UTSW 13 53,286,016 (GRCm39) missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53,439,536 (GRCm39) nonsense probably null
R4705:Ror2 UTSW 13 53,271,333 (GRCm39) missense probably benign 0.00
R4824:Ror2 UTSW 13 53,264,719 (GRCm39) missense probably benign 0.10
R4831:Ror2 UTSW 13 53,272,880 (GRCm39) missense probably damaging 0.97
R4951:Ror2 UTSW 13 53,271,183 (GRCm39) missense probably benign 0.00
R4975:Ror2 UTSW 13 53,285,954 (GRCm39) missense probably damaging 1.00
R5380:Ror2 UTSW 13 53,271,185 (GRCm39) missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53,271,375 (GRCm39) missense probably benign 0.00
R5604:Ror2 UTSW 13 53,271,201 (GRCm39) missense probably benign 0.01
R6188:Ror2 UTSW 13 53,265,347 (GRCm39) missense probably damaging 0.98
R6221:Ror2 UTSW 13 53,267,253 (GRCm39) missense probably damaging 1.00
R6243:Ror2 UTSW 13 53,267,116 (GRCm39) missense probably benign
R6255:Ror2 UTSW 13 53,264,578 (GRCm39) missense probably damaging 1.00
R6497:Ror2 UTSW 13 53,285,955 (GRCm39) missense probably damaging 1.00
R6717:Ror2 UTSW 13 53,273,018 (GRCm39) missense probably damaging 1.00
R6918:Ror2 UTSW 13 53,265,487 (GRCm39) missense probably damaging 0.96
R7092:Ror2 UTSW 13 53,264,272 (GRCm39) missense probably benign
R7134:Ror2 UTSW 13 53,300,742 (GRCm39) missense probably benign 0.00
R7254:Ror2 UTSW 13 53,272,756 (GRCm39) missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53,264,901 (GRCm39) missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53,264,849 (GRCm39) missense probably benign 0.05
R7746:Ror2 UTSW 13 53,271,261 (GRCm39) missense probably damaging 1.00
R8031:Ror2 UTSW 13 53,267,193 (GRCm39) missense probably damaging 1.00
R8479:Ror2 UTSW 13 53,271,400 (GRCm39) missense probably damaging 0.98
R8684:Ror2 UTSW 13 53,264,302 (GRCm39) missense possibly damaging 0.90
R8834:Ror2 UTSW 13 53,264,338 (GRCm39) small deletion probably benign
R8948:Ror2 UTSW 13 53,286,032 (GRCm39) missense possibly damaging 0.67
R9233:Ror2 UTSW 13 53,265,590 (GRCm39) missense probably benign
R9234:Ror2 UTSW 13 53,265,374 (GRCm39) missense probably damaging 1.00
R9573:Ror2 UTSW 13 53,265,467 (GRCm39) missense probably benign
R9665:Ror2 UTSW 13 53,439,561 (GRCm39) start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TCACAGTCTCAGGTGGGTAG -3'
(R):5'- AGTCCAGATCCCCATGCAGATG -3'

Sequencing Primer
(F):5'- TCTCAGGTGGGTAGGCTCAAAC -3'
(R):5'- ATGCAGATGGCCCCACAG -3'
Posted On 2014-06-23