Incidental Mutation 'R1823:Enc1'
ID206594
Institutional Source Beutler Lab
Gene Symbol Enc1
Ensembl Gene ENSMUSG00000041773
Gene Nameectodermal-neural cortex 1
SynonymsNrpb, PIG10
MMRRC Submission 039851-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1823 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location97241105-97253034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97245978 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 332 (E332G)
Ref Sequence ENSEMBL: ENSMUSP00000038783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041623
AA Change: E332G

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038783
Gene: ENSMUSG00000041773
AA Change: E332G

DomainStartEndE-ValueType
BTB 46 144 8.4e-32 SMART
BACK 149 251 7.5e-33 SMART
Kelch 296 340 3.89e0 SMART
Kelch 341 388 2.69e-9 SMART
Kelch 389 444 7.77e-15 SMART
Kelch 445 492 1.97e0 SMART
Kelch 493 538 2.9e-1 SMART
Kelch 539 585 1.5e-7 SMART
Meta Mutation Damage Score 0.2634 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-related family of actin-binding proteins. The encoded protein plays a role in the oxidative stress response as a regulator of the transcription factor Nrf2, and expression of this gene may play a role in malignant transformation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T C 15: 84,406,468 T213A probably benign Het
Adcy1 G A 11: 7,161,312 V868I probably benign Het
Ahnak G T 19: 9,004,905 M1184I probably damaging Het
Akap11 T C 14: 78,511,488 E1153G probably damaging Het
Amy1 T C 3: 113,562,727 N260S probably null Het
Ankrd6 A G 4: 32,824,427 L129P probably damaging Het
Aox2 A T 1: 58,312,359 T702S probably benign Het
Apobec1 G T 6: 122,578,886 T204K possibly damaging Het
Arhgef19 A G 4: 141,249,146 R433G probably benign Het
Atf6b T A 17: 34,648,644 H110Q possibly damaging Het
Btnl4 C T 17: 34,475,852 probably null Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cbs G A 17: 31,624,271 H229Y probably damaging Het
Cct8 G A 16: 87,490,554 R111* probably null Het
Cdc42bpb C T 12: 111,327,559 A250T probably damaging Het
Chrd A G 16: 20,741,347 probably benign Het
Ckap2l A G 2: 129,275,579 F559L probably damaging Het
D630003M21Rik T C 2: 158,217,557 Y141C probably damaging Het
Dbf4 T C 5: 8,397,539 N557S probably benign Het
Dct T G 14: 118,036,523 N324T probably benign Het
Dip2a A T 10: 76,278,502 L999* probably null Het
Dock10 T A 1: 80,543,097 probably null Het
Dync2li1 A T 17: 84,649,797 D330V probably damaging Het
Eif4g3 T A 4: 138,180,491 D1267E probably benign Het
Fat2 C T 11: 55,256,780 V3879I probably benign Het
Fh1 A T 1: 175,616,548 I117K probably damaging Het
Fkbp15 A G 4: 62,337,091 L227P probably damaging Het
Fpr1 T A 17: 17,877,053 M225L probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Grm7 A G 6: 111,207,769 T354A probably benign Het
Ift27 T A 15: 78,173,778 I9F possibly damaging Het
Igf1r A G 7: 68,194,981 D834G possibly damaging Het
Igsf9b T A 9: 27,331,732 L738Q probably damaging Het
Itgam A T 7: 128,064,732 T44S probably benign Het
Ivd T A 2: 118,862,034 I5N probably benign Het
Jcad T C 18: 4,675,780 S1181P probably damaging Het
Kctd18 A G 1: 57,956,365 V251A probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo18a T C 11: 77,825,097 probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myocd C A 11: 65,178,670 M909I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Nkpd1 G A 7: 19,523,252 V319M probably damaging Het
Olfr1216 A G 2: 89,013,378 S229P probably benign Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Olfr1453 C A 19: 13,027,817 V171L probably benign Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr366 T C 2: 37,220,332 V281A probably damaging Het
Olfr406 C T 11: 74,270,217 A276V probably damaging Het
Olfr450 G T 6: 42,818,268 A266S possibly damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pcdhb9 A G 18: 37,402,818 T622A probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 G T 10: 3,903,658 probably null Het
Plekhh2 A G 17: 84,575,189 Y708C probably damaging Het
Pnp T C 14: 50,950,329 F107L probably damaging Het
Postn T A 3: 54,385,287 probably null Het
Prcp A T 7: 92,928,675 D349V probably damaging Het
Prl3a1 A T 13: 27,270,194 I52F probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Rad9a A T 19: 4,197,242 I248N probably damaging Het
Ror2 T G 13: 53,110,305 E917A probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sema6d A G 2: 124,659,556 probably null Het
Slc4a2 C T 5: 24,427,620 A12V probably damaging Het
Slco6b1 T G 1: 96,961,176 noncoding transcript Het
Slf2 A T 19: 44,935,248 H167L possibly damaging Het
Snx9 G T 17: 5,920,671 G429V probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Spta1 T A 1: 174,246,549 D2351E probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Tatdn1 C T 15: 58,916,156 G171E probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tpm3-rs7 T C 14: 113,315,163 L163P possibly damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Ucp1 C T 8: 83,294,032 T157I probably damaging Het
Uspl1 T A 5: 149,214,414 L794Q probably benign Het
Vmn1r5 T A 6: 56,985,595 V85E probably damaging Het
Vmn1r58 A G 7: 5,410,406 I275T possibly damaging Het
Vmn2r79 A G 7: 87,037,872 I820M probably damaging Het
Wscd1 C A 11: 71,760,218 P124T probably benign Het
Zfp780b A T 7: 27,963,100 C677S possibly damaging Het
Other mutations in Enc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Enc1 APN 13 97245314 missense probably benign 0.00
IGL02010:Enc1 APN 13 97245080 missense possibly damaging 0.84
IGL02642:Enc1 APN 13 97245534 missense possibly damaging 0.84
IGL03342:Enc1 APN 13 97246470 missense possibly damaging 0.64
R1305:Enc1 UTSW 13 97246700 missense possibly damaging 0.58
R1419:Enc1 UTSW 13 97246184 missense probably damaging 1.00
R1733:Enc1 UTSW 13 97245042 missense possibly damaging 0.63
R1796:Enc1 UTSW 13 97246483 missense probably benign 0.00
R1796:Enc1 UTSW 13 97246485 missense possibly damaging 0.58
R4107:Enc1 UTSW 13 97245138 missense probably damaging 1.00
R4324:Enc1 UTSW 13 97245897 missense probably benign 0.21
R4922:Enc1 UTSW 13 97245735 missense probably benign 0.08
R5942:Enc1 UTSW 13 97246379 missense probably benign 0.28
R5951:Enc1 UTSW 13 97245257 missense probably benign 0.02
R6229:Enc1 UTSW 13 97245491 missense probably benign
R6985:Enc1 UTSW 13 97245120 missense possibly damaging 0.92
R6987:Enc1 UTSW 13 97245636 missense probably benign 0.14
R7307:Enc1 UTSW 13 97245093 missense probably damaging 1.00
R7442:Enc1 UTSW 13 97246740 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCGATGGAAGAACTCATCACC -3'
(R):5'- AGGCAGTGCTTCAGTTCAGC -3'

Sequencing Primer
(F):5'- AGGCCATCAGGTGCAAAC -3'
(R):5'- TCAGTTCAGCAGATCCATGG -3'
Posted On2014-06-23