Mutagenetix > Incidental Mutation

Incidental Mutation 'R1823:Snx9'

206609

Institutional Source

Beutler Lab

Gene Symbol

Snx9

Ensembl Gene

ENSMUSG00000002365

Gene Name

sorting nexin 9

Synonyms

SH3PX1, SDP1

MMRRC Submission

039851-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.869) question?

Stock #

R1823 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5841329-5931954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 5920671 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 429 (G429V)

Ref Sequence

ENSEMBL: ENSMUSP00000002436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002436]

AlphaFold

Q91VH2

PDB Structure

Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002436
AA Change: G429V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: G429V

Domain	Start	End	E-Value	Type
SH3	3	61	1.51e-16	SMART
low complexity region	84	100	N/A	INTRINSIC
low complexity region	160	170	N/A	INTRINSIC
PX	247	357	4.15e-23	SMART
Pfam:BAR_3_WASP_bdg	358	593	2.4e-120	PFAM

Meta Mutation Damage Score

0.5671

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.6%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	T	C	15: 84,406,468	T213A	probably benign	Het
Adcy1	G	A	11: 7,161,312	V868I	probably benign	Het
Ahnak	G	T	19: 9,004,905	M1184I	probably damaging	Het
Akap11	T	C	14: 78,511,488	E1153G	probably damaging	Het
Amy1	T	C	3: 113,562,727	N260S	probably null	Het
Ankrd6	A	G	4: 32,824,427	L129P	probably damaging	Het
Aox2	A	T	1: 58,312,359	T702S	probably benign	Het
Apobec1	G	T	6: 122,578,886	T204K	possibly damaging	Het
Arhgef19	A	G	4: 141,249,146	R433G	probably benign	Het
Atf6b	T	A	17: 34,648,644	H110Q	possibly damaging	Het
Btnl4	C	T	17: 34,475,852		probably null	Het
Camsap2	T	C	1: 136,273,783	T662A	possibly damaging	Het
Cbs	G	A	17: 31,624,271	H229Y	probably damaging	Het
Cct8	G	A	16: 87,490,554	R111*	probably null	Het
Cdc42bpb	C	T	12: 111,327,559	A250T	probably damaging	Het
Chrd	A	G	16: 20,741,347		probably benign	Het
Ckap2l	A	G	2: 129,275,579	F559L	probably damaging	Het
D630003M21Rik	T	C	2: 158,217,557	Y141C	probably damaging	Het
Dbf4	T	C	5: 8,397,539	N557S	probably benign	Het
Dct	T	G	14: 118,036,523	N324T	probably benign	Het
Dip2a	A	T	10: 76,278,502	L999*	probably null	Het
Dock10	T	A	1: 80,543,097		probably null	Het
Dync2li1	A	T	17: 84,649,797	D330V	probably damaging	Het
Eif4g3	T	A	4: 138,180,491	D1267E	probably benign	Het
Enc1	A	G	13: 97,245,978	E332G	possibly damaging	Het
Fat2	C	T	11: 55,256,780	V3879I	probably benign	Het
Fh1	A	T	1: 175,616,548	I117K	probably damaging	Het
Fkbp15	A	G	4: 62,337,091	L227P	probably damaging	Het
Fpr1	T	A	17: 17,877,053	M225L	probably benign	Het
Fras1	A	T	5: 96,770,688	I3528F	probably damaging	Het
Grm7	A	G	6: 111,207,769	T354A	probably benign	Het
Ift27	T	A	15: 78,173,778	I9F	possibly damaging	Het
Igf1r	A	G	7: 68,194,981	D834G	possibly damaging	Het
Igsf9b	T	A	9: 27,331,732	L738Q	probably damaging	Het
Itgam	A	T	7: 128,064,732	T44S	probably benign	Het
Ivd	T	A	2: 118,862,034	I5N	probably benign	Het
Jcad	T	C	18: 4,675,780	S1181P	probably damaging	Het
Kctd18	A	G	1: 57,956,365	V251A	probably benign	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo18a	T	C	11: 77,825,097		probably benign	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myocd	C	A	11: 65,178,670	M909I	probably benign	Het
Ndufv3	G	A	17: 31,531,245	R467Q	probably damaging	Het
Nkpd1	G	A	7: 19,523,252	V319M	probably damaging	Het
Olfr1216	A	G	2: 89,013,378	S229P	probably benign	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Olfr1453	C	A	19: 13,027,817	V171L	probably benign	Het
Olfr31	T	A	14: 14,328,774	L221Q	probably damaging	Het
Olfr366	T	C	2: 37,220,332	V281A	probably damaging	Het
Olfr406	C	T	11: 74,270,217	A276V	probably damaging	Het
Olfr450	G	T	6: 42,818,268	A266S	possibly damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pcdhb9	A	G	18: 37,402,818	T622A	probably benign	Het
Pdpk1	A	T	17: 24,098,176		probably benign	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	G	T	10: 3,903,658		probably null	Het
Plekhh2	A	G	17: 84,575,189	Y708C	probably damaging	Het
Pnp	T	C	14: 50,950,329	F107L	probably damaging	Het
Postn	T	A	3: 54,385,287		probably null	Het
Prcp	A	T	7: 92,928,675	D349V	probably damaging	Het
Prl3a1	A	T	13: 27,270,194	I52F	probably damaging	Het
Pym1	G	A	10: 128,766,044		probably benign	Het
Rad9a	A	T	19: 4,197,242	I248N	probably damaging	Het
Ror2	T	G	13: 53,110,305	E917A	probably benign	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sema6d	A	G	2: 124,659,556		probably null	Het
Slc4a2	C	T	5: 24,427,620	A12V	probably damaging	Het
Slco6b1	T	G	1: 96,961,176		noncoding transcript	Het
Slf2	A	T	19: 44,935,248	H167L	possibly damaging	Het
Sod3	G	T	5: 52,368,162	V68L	probably benign	Het
Spta1	T	A	1: 174,246,549	D2351E	probably benign	Het
Srpk3	G	A	X: 73,777,955	R425Q	possibly damaging	Het
Tatdn1	C	T	15: 58,916,156	G171E	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnfsf9	A	G	17: 57,105,738	T103A	probably benign	Het
Tpm3-rs7	T	C	14: 113,315,163	L163P	possibly damaging	Het
Trim52	T	A	14: 106,106,967	C20S	probably damaging	Het
Ucp1	C	T	8: 83,294,032	T157I	probably damaging	Het
Uspl1	T	A	5: 149,214,414	L794Q	probably benign	Het
Vmn1r5	T	A	6: 56,985,595	V85E	probably damaging	Het
Vmn1r58	A	G	7: 5,410,406	I275T	possibly damaging	Het
Vmn2r79	A	G	7: 87,037,872	I820M	probably damaging	Het
Wscd1	C	A	11: 71,760,218	P124T	probably benign	Het
Zfp780b	A	T	7: 27,963,100	C677S	possibly damaging	Het

Other mutations in Snx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Snx9	APN	17	5899361	missense	probably benign
IGL00417:Snx9	APN	17	5891897	missense	probably benign	0.03
IGL01827:Snx9	APN	17	5887012	missense	probably benign	0.04
IGL02531:Snx9	APN	17	5891820	missense	probably benign
IGL02710:Snx9	APN	17	5908598	missense	probably damaging	1.00
IGL03088:Snx9	APN	17	5924610	missense	probably benign
san_angelo	UTSW	17	5891809	nonsense	probably null
PIT4495001:Snx9	UTSW	17	5920126	missense	possibly damaging	0.54
R0555:Snx9	UTSW	17	5918413	missense	probably damaging	0.97
R1015:Snx9	UTSW	17	5920127	missense	probably benign	0.12
R1065:Snx9	UTSW	17	5902361	splice site	probably benign
R1421:Snx9	UTSW	17	5902484	missense	probably benign	0.45
R1657:Snx9	UTSW	17	5918436	missense	possibly damaging	0.65
R1914:Snx9	UTSW	17	5928256	missense	possibly damaging	0.65
R3703:Snx9	UTSW	17	5928200	splice site	probably null
R3871:Snx9	UTSW	17	5891781	missense	probably benign	0.00
R4375:Snx9	UTSW	17	5908626	nonsense	probably null
R4412:Snx9	UTSW	17	5908394	missense	probably damaging	0.96
R4669:Snx9	UTSW	17	5927224	missense	probably damaging	1.00
R4974:Snx9	UTSW	17	5902519	splice site	probably null
R5038:Snx9	UTSW	17	5887073	missense	probably benign	0.12
R5137:Snx9	UTSW	17	5928253	missense	probably damaging	1.00
R5369:Snx9	UTSW	17	5920580	missense	probably damaging	1.00
R5459:Snx9	UTSW	17	5920638	missense	probably damaging	0.99
R5624:Snx9	UTSW	17	5891809	nonsense	probably null
R5847:Snx9	UTSW	17	5924621	missense	possibly damaging	0.94
R5953:Snx9	UTSW	17	5908402	missense	probably damaging	1.00
R5953:Snx9	UTSW	17	5908403	missense	probably damaging	1.00
R6263:Snx9	UTSW	17	5887049	missense	probably damaging	0.98
R6481:Snx9	UTSW	17	5922209	critical splice donor site	probably null
R6491:Snx9	UTSW	17	5920162	missense	probably benign	0.00
R7873:Snx9	UTSW	17	5918476	missense	possibly damaging	0.81
R8471:Snx9	UTSW	17	5890090	missense	probably damaging	1.00
R9451:Snx9	UTSW	17	5899493	missense	probably damaging	0.99
R9748:Snx9	UTSW	17	5899395	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTGGAGCTTGCAGACATTG -3'
(R):5'- ACGGCTCTTTGTAGCTCTGC -3'

Sequencing Primer
(F):5'- AGCTTGCAGACATTGTGTTTG -3'
(R):5'- TGCTATCACTTGCAAGGGTAAAGC -3'

Posted On

2014-06-23