Incidental Mutation 'R1823:Plekhh2'
ID206618
Institutional Source Beutler Lab
Gene Symbol Plekhh2
Ensembl Gene ENSMUSG00000040852
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Synonyms
MMRRC Submission 039851-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1823 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84511895-84622142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84575189 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 708 (Y708C)
Ref Sequence ENSEMBL: ENSMUSP00000039628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047206]
Predicted Effect probably damaging
Transcript: ENSMUST00000047206
AA Change: Y708C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: Y708C

DomainStartEndE-ValueType
coiled coil region 19 84 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
coiled coil region 137 174 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
low complexity region 612 651 N/A INTRINSIC
low complexity region 657 666 N/A INTRINSIC
PH 703 798 4.7e-19 SMART
PH 811 920 1.15e-4 SMART
MyTH4 954 1109 8.49e-39 SMART
B41 1116 1353 1.01e-27 SMART
Meta Mutation Damage Score 0.7585 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T C 15: 84,406,468 T213A probably benign Het
Adcy1 G A 11: 7,161,312 V868I probably benign Het
Ahnak G T 19: 9,004,905 M1184I probably damaging Het
Akap11 T C 14: 78,511,488 E1153G probably damaging Het
Amy1 T C 3: 113,562,727 N260S probably null Het
Ankrd6 A G 4: 32,824,427 L129P probably damaging Het
Aox2 A T 1: 58,312,359 T702S probably benign Het
Apobec1 G T 6: 122,578,886 T204K possibly damaging Het
Arhgef19 A G 4: 141,249,146 R433G probably benign Het
Atf6b T A 17: 34,648,644 H110Q possibly damaging Het
Btnl4 C T 17: 34,475,852 probably null Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cbs G A 17: 31,624,271 H229Y probably damaging Het
Cct8 G A 16: 87,490,554 R111* probably null Het
Cdc42bpb C T 12: 111,327,559 A250T probably damaging Het
Chrd A G 16: 20,741,347 probably benign Het
Ckap2l A G 2: 129,275,579 F559L probably damaging Het
D630003M21Rik T C 2: 158,217,557 Y141C probably damaging Het
Dbf4 T C 5: 8,397,539 N557S probably benign Het
Dct T G 14: 118,036,523 N324T probably benign Het
Dip2a A T 10: 76,278,502 L999* probably null Het
Dock10 T A 1: 80,543,097 probably null Het
Dync2li1 A T 17: 84,649,797 D330V probably damaging Het
Eif4g3 T A 4: 138,180,491 D1267E probably benign Het
Enc1 A G 13: 97,245,978 E332G possibly damaging Het
Fat2 C T 11: 55,256,780 V3879I probably benign Het
Fh1 A T 1: 175,616,548 I117K probably damaging Het
Fkbp15 A G 4: 62,337,091 L227P probably damaging Het
Fpr1 T A 17: 17,877,053 M225L probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Grm7 A G 6: 111,207,769 T354A probably benign Het
Ift27 T A 15: 78,173,778 I9F possibly damaging Het
Igf1r A G 7: 68,194,981 D834G possibly damaging Het
Igsf9b T A 9: 27,331,732 L738Q probably damaging Het
Itgam A T 7: 128,064,732 T44S probably benign Het
Ivd T A 2: 118,862,034 I5N probably benign Het
Jcad T C 18: 4,675,780 S1181P probably damaging Het
Kctd18 A G 1: 57,956,365 V251A probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo18a T C 11: 77,825,097 probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myocd C A 11: 65,178,670 M909I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Nkpd1 G A 7: 19,523,252 V319M probably damaging Het
Olfr1216 A G 2: 89,013,378 S229P probably benign Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Olfr1453 C A 19: 13,027,817 V171L probably benign Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr366 T C 2: 37,220,332 V281A probably damaging Het
Olfr406 C T 11: 74,270,217 A276V probably damaging Het
Olfr450 G T 6: 42,818,268 A266S possibly damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pcdhb9 A G 18: 37,402,818 T622A probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 G T 10: 3,903,658 probably null Het
Pnp T C 14: 50,950,329 F107L probably damaging Het
Postn T A 3: 54,385,287 probably null Het
Prcp A T 7: 92,928,675 D349V probably damaging Het
Prl3a1 A T 13: 27,270,194 I52F probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Rad9a A T 19: 4,197,242 I248N probably damaging Het
Ror2 T G 13: 53,110,305 E917A probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sema6d A G 2: 124,659,556 probably null Het
Slc4a2 C T 5: 24,427,620 A12V probably damaging Het
Slco6b1 T G 1: 96,961,176 noncoding transcript Het
Slf2 A T 19: 44,935,248 H167L possibly damaging Het
Snx9 G T 17: 5,920,671 G429V probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Spta1 T A 1: 174,246,549 D2351E probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Tatdn1 C T 15: 58,916,156 G171E probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tpm3-rs7 T C 14: 113,315,163 L163P possibly damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Ucp1 C T 8: 83,294,032 T157I probably damaging Het
Uspl1 T A 5: 149,214,414 L794Q probably benign Het
Vmn1r5 T A 6: 56,985,595 V85E probably damaging Het
Vmn1r58 A G 7: 5,410,406 I275T possibly damaging Het
Vmn2r79 A G 7: 87,037,872 I820M probably damaging Het
Wscd1 C A 11: 71,760,218 P124T probably benign Het
Zfp780b A T 7: 27,963,100 C677S possibly damaging Het
Other mutations in Plekhh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Plekhh2 APN 17 84521775 missense probably benign 0.00
IGL00514:Plekhh2 APN 17 84596306 critical splice donor site probably null
IGL00773:Plekhh2 APN 17 84606868 missense probably benign 0.01
IGL00985:Plekhh2 APN 17 84563928 missense probably benign 0.00
IGL01116:Plekhh2 APN 17 84606928 missense possibly damaging 0.94
IGL01394:Plekhh2 APN 17 84557430 missense probably benign 0.24
IGL01419:Plekhh2 APN 17 84583552 splice site probably benign
IGL01932:Plekhh2 APN 17 84577261 missense probably benign 0.00
IGL02097:Plekhh2 APN 17 84599180 missense possibly damaging 0.69
IGL02157:Plekhh2 APN 17 84566942 splice site probably benign
IGL02163:Plekhh2 APN 17 84590795 missense probably benign 0.45
IGL02237:Plekhh2 APN 17 84575785 missense probably benign 0.00
IGL02322:Plekhh2 APN 17 84589466 nonsense probably null
IGL02422:Plekhh2 APN 17 84563809 splice site probably benign
IGL02483:Plekhh2 APN 17 84596260 missense possibly damaging 0.81
IGL02493:Plekhh2 APN 17 84606963 critical splice donor site probably null
IGL03007:Plekhh2 APN 17 84574960 missense possibly damaging 0.65
R0003:Plekhh2 UTSW 17 84557392 missense probably damaging 1.00
R0005:Plekhh2 UTSW 17 84586433 missense probably benign 0.16
R0099:Plekhh2 UTSW 17 84591672 nonsense probably null
R0331:Plekhh2 UTSW 17 84586366 missense possibly damaging 0.81
R0883:Plekhh2 UTSW 17 84618031 missense probably benign 0.11
R1051:Plekhh2 UTSW 17 84521827 critical splice donor site probably null
R1084:Plekhh2 UTSW 17 84571126 missense probably damaging 0.99
R1351:Plekhh2 UTSW 17 84577146 splice site probably benign
R1459:Plekhh2 UTSW 17 84610775 nonsense probably null
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1510:Plekhh2 UTSW 17 84559576 splice site probably null
R1699:Plekhh2 UTSW 17 84577184 nonsense probably null
R1738:Plekhh2 UTSW 17 84566697 missense possibly damaging 0.67
R1773:Plekhh2 UTSW 17 84599265 missense probably damaging 1.00
R1796:Plekhh2 UTSW 17 84599133 critical splice acceptor site probably null
R1998:Plekhh2 UTSW 17 84606877 missense possibly damaging 0.58
R2437:Plekhh2 UTSW 17 84586479 splice site probably null
R2847:Plekhh2 UTSW 17 84597966 missense probably damaging 1.00
R4088:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R4227:Plekhh2 UTSW 17 84566795 missense probably benign 0.00
R4249:Plekhh2 UTSW 17 84586337 missense possibly damaging 0.93
R4347:Plekhh2 UTSW 17 84619702 missense probably benign 0.12
R4562:Plekhh2 UTSW 17 84566097 missense probably benign 0.00
R4649:Plekhh2 UTSW 17 84575263 missense probably damaging 1.00
R4737:Plekhh2 UTSW 17 84563959 missense probably benign
R4743:Plekhh2 UTSW 17 84571120 missense probably damaging 1.00
R4858:Plekhh2 UTSW 17 84600697 missense probably damaging 1.00
R5036:Plekhh2 UTSW 17 84571761 missense probably damaging 0.99
R5260:Plekhh2 UTSW 17 84577165 missense probably damaging 0.99
R5385:Plekhh2 UTSW 17 84557466 missense probably benign 0.00
R5409:Plekhh2 UTSW 17 84586478 critical splice donor site probably null
R5510:Plekhh2 UTSW 17 84566847 missense probably benign
R5557:Plekhh2 UTSW 17 84560152 missense probably benign 0.10
R5684:Plekhh2 UTSW 17 84597918 missense probably damaging 1.00
R5685:Plekhh2 UTSW 17 84569882 missense probably damaging 1.00
R5724:Plekhh2 UTSW 17 84566805 missense probably benign 0.00
R5742:Plekhh2 UTSW 17 84597980 missense probably damaging 1.00
R5817:Plekhh2 UTSW 17 84571726 missense possibly damaging 0.86
R6218:Plekhh2 UTSW 17 84591564 missense probably benign 0.03
R6334:Plekhh2 UTSW 17 84566866 missense probably benign
R6345:Plekhh2 UTSW 17 84575787 missense probably benign 0.01
R6617:Plekhh2 UTSW 17 84566287 missense possibly damaging 0.65
R6755:Plekhh2 UTSW 17 84591585 missense probably damaging 1.00
R6864:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R7171:Plekhh2 UTSW 17 84521788 missense probably damaging 0.96
R7413:Plekhh2 UTSW 17 84566296 missense probably benign 0.03
R7585:Plekhh2 UTSW 17 84577180 missense probably benign 0.11
R7640:Plekhh2 UTSW 17 84610776 missense possibly damaging 0.50
R7733:Plekhh2 UTSW 17 84583524 nonsense probably null
R7877:Plekhh2 UTSW 17 84575006 missense probably benign
R8085:Plekhh2 UTSW 17 84597956 missense probably damaging 0.98
R8206:Plekhh2 UTSW 17 84590849 missense possibly damaging 0.47
R8296:Plekhh2 UTSW 17 84600685 missense probably damaging 0.98
R8344:Plekhh2 UTSW 17 84571761 missense possibly damaging 0.64
R8438:Plekhh2 UTSW 17 84569951 missense probably benign
R8487:Plekhh2 UTSW 17 84557481 missense possibly damaging 0.55
R8708:Plekhh2 UTSW 17 84574993 missense probably benign 0.00
R8830:Plekhh2 UTSW 17 84521803 missense probably damaging 1.00
R8847:Plekhh2 UTSW 17 84571051 missense probably benign 0.00
R8918:Plekhh2 UTSW 17 84599193 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACTATGCCATTCCTCCGGATG -3'
(R):5'- AGTCTGTTTTACAGTGTGAGGAAC -3'

Sequencing Primer
(F):5'- TATCCCATAGACGCAGAGTGTTCG -3'
(R):5'- AGGAACTCAGGCCCTAACGG -3'
Posted On2014-06-23