Incidental Mutation 'R1823:Pcdhb9'
ID 206621
Institutional Source Beutler Lab
Gene Symbol Pcdhb9
Ensembl Gene ENSMUSG00000051242
Gene Name protocadherin beta 9
Synonyms Pcdhb4C, PcdhbI
MMRRC Submission 039851-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R1823 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 37533908-37536962 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37535871 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 622 (T622A)
Ref Sequence ENSEMBL: ENSMUSP00000058801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057228] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold E9Q5G2
Predicted Effect probably benign
Transcript: ENSMUST00000057228
AA Change: T622A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000058801
Gene: ENSMUSG00000051242
AA Change: T622A

DomainStartEndE-ValueType
Pfam:Cadherin_2 65 147 2.3e-33 PFAM
CA 190 275 1.28e-17 SMART
CA 299 380 7.6e-25 SMART
CA 403 484 5.81e-21 SMART
CA 508 594 9.8e-28 SMART
CA 624 705 1.86e-10 SMART
Pfam:Cadherin_C_2 722 805 2.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.2335 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 G A 11: 7,111,312 (GRCm39) V868I probably benign Het
Ahnak G T 19: 8,982,269 (GRCm39) M1184I probably damaging Het
Akap11 T C 14: 78,748,928 (GRCm39) E1153G probably damaging Het
Amy1 T C 3: 113,356,376 (GRCm39) N260S probably null Het
Ankrd6 A G 4: 32,824,427 (GRCm39) L129P probably damaging Het
Aox1 A T 1: 58,351,518 (GRCm39) T702S probably benign Het
Apobec1 G T 6: 122,555,845 (GRCm39) T204K possibly damaging Het
Arhgef19 A G 4: 140,976,457 (GRCm39) R433G probably benign Het
Atf6b T A 17: 34,867,618 (GRCm39) H110Q possibly damaging Het
Btnl4 C T 17: 34,694,826 (GRCm39) probably null Het
Camsap2 T C 1: 136,201,521 (GRCm39) T662A possibly damaging Het
Cbs G A 17: 31,843,245 (GRCm39) H229Y probably damaging Het
Cct8 G A 16: 87,287,442 (GRCm39) R111* probably null Het
Cdc42bpb C T 12: 111,293,993 (GRCm39) A250T probably damaging Het
Chrd A G 16: 20,560,097 (GRCm39) probably benign Het
Ckap2l A G 2: 129,117,499 (GRCm39) F559L probably damaging Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
D630003M21Rik T C 2: 158,059,477 (GRCm39) Y141C probably damaging Het
Dbf4 T C 5: 8,447,539 (GRCm39) N557S probably benign Het
Dct T G 14: 118,273,935 (GRCm39) N324T probably benign Het
Dip2a A T 10: 76,114,336 (GRCm39) L999* probably null Het
Dock10 T A 1: 80,520,814 (GRCm39) probably null Het
Dync2li1 A T 17: 84,957,225 (GRCm39) D330V probably damaging Het
Eif4g3 T A 4: 137,907,802 (GRCm39) D1267E probably benign Het
Enc1 A G 13: 97,382,486 (GRCm39) E332G possibly damaging Het
Fat2 C T 11: 55,147,606 (GRCm39) V3879I probably benign Het
Fh1 A T 1: 175,444,114 (GRCm39) I117K probably damaging Het
Fkbp15 A G 4: 62,255,328 (GRCm39) L227P probably damaging Het
Fpr1 T A 17: 18,097,315 (GRCm39) M225L probably benign Het
Fras1 A T 5: 96,918,547 (GRCm39) I3528F probably damaging Het
Grm7 A G 6: 111,184,730 (GRCm39) T354A probably benign Het
Ift27 T A 15: 78,057,978 (GRCm39) I9F possibly damaging Het
Igf1r A G 7: 67,844,729 (GRCm39) D834G possibly damaging Het
Igsf9b T A 9: 27,243,028 (GRCm39) L738Q probably damaging Het
Itgam A T 7: 127,663,904 (GRCm39) T44S probably benign Het
Ivd T A 2: 118,692,515 (GRCm39) I5N probably benign Het
Jcad T C 18: 4,675,780 (GRCm39) S1181P probably damaging Het
Kctd18 A G 1: 57,995,524 (GRCm39) V251A probably benign Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo18a T C 11: 77,715,923 (GRCm39) probably benign Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myocd C A 11: 65,069,496 (GRCm39) M909I probably benign Het
Ndufv3 G A 17: 31,750,219 (GRCm39) R467Q probably damaging Het
Nkpd1 G A 7: 19,257,177 (GRCm39) V319M probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or1af1 T C 2: 37,110,344 (GRCm39) V281A probably damaging Het
Or1p1c C T 11: 74,161,043 (GRCm39) A276V probably damaging Het
Or2q1 G T 6: 42,795,202 (GRCm39) A266S possibly damaging Het
Or2t1 T A 14: 14,328,774 (GRCm38) L221Q probably damaging Het
Or4c111 A G 2: 88,843,722 (GRCm39) S229P probably benign Het
Or5b101 C A 19: 13,005,181 (GRCm39) V171L probably benign Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pdpk1 A T 17: 24,317,150 (GRCm39) probably benign Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 G T 10: 3,853,658 (GRCm39) probably null Het
Plekhh2 A G 17: 84,882,617 (GRCm39) Y708C probably damaging Het
Pnp T C 14: 51,187,786 (GRCm39) F107L probably damaging Het
Postn T A 3: 54,292,708 (GRCm39) probably null Het
Prcp A T 7: 92,577,883 (GRCm39) D349V probably damaging Het
Prl3a1 A T 13: 27,454,177 (GRCm39) I52F probably damaging Het
Pym1 G A 10: 128,601,913 (GRCm39) probably benign Het
Rad9a A T 19: 4,247,241 (GRCm39) I248N probably damaging Het
Ror2 T G 13: 53,264,341 (GRCm39) E917A probably benign Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sema6d A G 2: 124,501,476 (GRCm39) probably null Het
Shisal1 T C 15: 84,290,669 (GRCm39) T213A probably benign Het
Slc4a2 C T 5: 24,632,618 (GRCm39) A12V probably damaging Het
Slco6b1 T G 1: 96,888,901 (GRCm39) noncoding transcript Het
Slf2 A T 19: 44,923,687 (GRCm39) H167L possibly damaging Het
Snx9 G T 17: 5,970,946 (GRCm39) G429V probably damaging Het
Sod3 G T 5: 52,525,504 (GRCm39) V68L probably benign Het
Spta1 T A 1: 174,074,115 (GRCm39) D2351E probably benign Het
Srpk3 G A X: 72,821,561 (GRCm39) R425Q possibly damaging Het
Tatdn1 C T 15: 58,788,005 (GRCm39) G171E probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Tnfsf9 A G 17: 57,412,738 (GRCm39) T103A probably benign Het
Tpm3-rs7 T C 14: 113,552,595 (GRCm39) L163P possibly damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Ucp1 C T 8: 84,020,661 (GRCm39) T157I probably damaging Het
Uspl1 T A 5: 149,151,224 (GRCm39) L794Q probably benign Het
Vmn1r5 T A 6: 56,962,580 (GRCm39) V85E probably damaging Het
Vmn1r58 A G 7: 5,413,405 (GRCm39) I275T possibly damaging Het
Vmn2r79 A G 7: 86,687,080 (GRCm39) I820M probably damaging Het
Wscd1 C A 11: 71,651,044 (GRCm39) P124T probably benign Het
Zfp780b A T 7: 27,662,525 (GRCm39) C677S possibly damaging Het
Other mutations in Pcdhb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pcdhb9 APN 18 37,536,332 (GRCm39) missense possibly damaging 0.59
IGL01557:Pcdhb9 APN 18 37,536,100 (GRCm39) missense probably damaging 1.00
IGL01716:Pcdhb9 APN 18 37,536,228 (GRCm39) missense probably damaging 0.99
IGL01954:Pcdhb9 APN 18 37,534,794 (GRCm39) missense probably damaging 1.00
IGL02063:Pcdhb9 APN 18 37,534,810 (GRCm39) missense probably benign 0.21
IGL03057:Pcdhb9 APN 18 37,534,330 (GRCm39) missense probably benign 0.00
R0140:Pcdhb9 UTSW 18 37,536,014 (GRCm39) missense possibly damaging 0.89
R0180:Pcdhb9 UTSW 18 37,535,307 (GRCm39) missense probably damaging 1.00
R0349:Pcdhb9 UTSW 18 37,535,632 (GRCm39) missense probably damaging 0.99
R0616:Pcdhb9 UTSW 18 37,535,028 (GRCm39) nonsense probably null
R0669:Pcdhb9 UTSW 18 37,535,308 (GRCm39) missense probably damaging 1.00
R1256:Pcdhb9 UTSW 18 37,536,169 (GRCm39) missense possibly damaging 0.94
R1642:Pcdhb9 UTSW 18 37,533,987 (GRCm39) intron probably benign
R1678:Pcdhb9 UTSW 18 37,534,682 (GRCm39) missense probably damaging 1.00
R1711:Pcdhb9 UTSW 18 37,536,380 (GRCm39) nonsense probably null
R1762:Pcdhb9 UTSW 18 37,536,136 (GRCm39) missense probably benign 0.00
R1868:Pcdhb9 UTSW 18 37,535,137 (GRCm39) missense probably damaging 1.00
R1959:Pcdhb9 UTSW 18 37,536,369 (GRCm39) missense probably damaging 1.00
R2446:Pcdhb9 UTSW 18 37,536,340 (GRCm39) missense probably damaging 0.99
R2889:Pcdhb9 UTSW 18 37,536,276 (GRCm39) missense probably benign 0.06
R2890:Pcdhb9 UTSW 18 37,536,379 (GRCm39) missense probably benign 0.23
R3196:Pcdhb9 UTSW 18 37,534,663 (GRCm39) missense probably benign 0.02
R3725:Pcdhb9 UTSW 18 37,534,654 (GRCm39) missense possibly damaging 0.95
R3726:Pcdhb9 UTSW 18 37,534,654 (GRCm39) missense possibly damaging 0.95
R4179:Pcdhb9 UTSW 18 37,534,168 (GRCm39) missense probably benign 0.17
R4326:Pcdhb9 UTSW 18 37,534,876 (GRCm39) missense probably benign 0.15
R4326:Pcdhb9 UTSW 18 37,534,875 (GRCm39) missense probably benign 0.04
R4327:Pcdhb9 UTSW 18 37,534,876 (GRCm39) missense probably benign 0.15
R4327:Pcdhb9 UTSW 18 37,534,875 (GRCm39) missense probably benign 0.04
R4329:Pcdhb9 UTSW 18 37,534,876 (GRCm39) missense probably benign 0.15
R4329:Pcdhb9 UTSW 18 37,534,875 (GRCm39) missense probably benign 0.04
R4626:Pcdhb9 UTSW 18 37,535,302 (GRCm39) missense probably benign 0.01
R4738:Pcdhb9 UTSW 18 37,536,468 (GRCm39) missense probably benign 0.33
R4888:Pcdhb9 UTSW 18 37,536,286 (GRCm39) missense probably benign 0.22
R5140:Pcdhb9 UTSW 18 37,534,186 (GRCm39) missense probably benign 0.00
R5186:Pcdhb9 UTSW 18 37,534,285 (GRCm39) missense probably damaging 1.00
R5502:Pcdhb9 UTSW 18 37,534,656 (GRCm39) missense possibly damaging 0.95
R5586:Pcdhb9 UTSW 18 37,534,167 (GRCm39) missense probably benign
R5601:Pcdhb9 UTSW 18 37,535,259 (GRCm39) missense probably damaging 1.00
R5624:Pcdhb9 UTSW 18 37,534,459 (GRCm39) missense probably benign
R5827:Pcdhb9 UTSW 18 37,535,011 (GRCm39) missense possibly damaging 0.72
R5829:Pcdhb9 UTSW 18 37,534,942 (GRCm39) missense probably damaging 0.97
R5837:Pcdhb9 UTSW 18 37,535,851 (GRCm39) missense probably damaging 1.00
R6147:Pcdhb9 UTSW 18 37,535,494 (GRCm39) missense possibly damaging 0.95
R6228:Pcdhb9 UTSW 18 37,535,115 (GRCm39) missense probably benign 0.00
R6245:Pcdhb9 UTSW 18 37,536,207 (GRCm39) missense probably damaging 1.00
R6304:Pcdhb9 UTSW 18 37,534,420 (GRCm39) missense probably damaging 0.99
R6542:Pcdhb9 UTSW 18 37,534,642 (GRCm39) missense probably damaging 0.99
R6904:Pcdhb9 UTSW 18 37,534,970 (GRCm39) missense probably benign 0.01
R7058:Pcdhb9 UTSW 18 37,536,334 (GRCm39) missense probably benign 0.35
R7159:Pcdhb9 UTSW 18 37,534,545 (GRCm39) missense possibly damaging 0.89
R7258:Pcdhb9 UTSW 18 37,535,167 (GRCm39) missense probably damaging 1.00
R7800:Pcdhb9 UTSW 18 37,534,602 (GRCm39) missense probably benign 0.01
R8027:Pcdhb9 UTSW 18 37,536,069 (GRCm39) missense possibly damaging 0.81
R8141:Pcdhb9 UTSW 18 37,535,361 (GRCm39) missense probably damaging 1.00
R8157:Pcdhb9 UTSW 18 37,536,208 (GRCm39) missense probably damaging 1.00
R8729:Pcdhb9 UTSW 18 37,535,639 (GRCm39) missense possibly damaging 0.88
R8748:Pcdhb9 UTSW 18 37,535,901 (GRCm39) missense probably damaging 1.00
R8833:Pcdhb9 UTSW 18 37,534,468 (GRCm39) missense probably benign
R9083:Pcdhb9 UTSW 18 37,535,770 (GRCm39) missense probably damaging 1.00
R9562:Pcdhb9 UTSW 18 37,534,665 (GRCm39) missense probably benign
R9779:Pcdhb9 UTSW 18 37,535,253 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACAATGGGCAGCTGTTTG -3'
(R):5'- TCCTTGACCACCAGCAGTAG -3'

Sequencing Primer
(F):5'- GCAGCTGTTTGCACTCAG -3'
(R):5'- ACCACCAGCAGTAGCCTGTG -3'
Posted On 2014-06-23