Incidental Mutation 'R1823:Rad9a'
ID 206622
Institutional Source Beutler Lab
Gene Symbol Rad9a
Ensembl Gene ENSMUSG00000024824
Gene Name RAD9 checkpoint clamp component A
Synonyms Rad9
MMRRC Submission 039851-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1823 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 4245195-4251661 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4247241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 248 (I248N)
Ref Sequence ENSEMBL: ENSMUSP00000025740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025740] [ENSMUST00000046094]
AlphaFold Q9Z0F6
Predicted Effect probably damaging
Transcript: ENSMUST00000025740
AA Change: I248N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025740
Gene: ENSMUSG00000024824
AA Change: I248N

DomainStartEndE-ValueType
Pfam:Rad9 13 265 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046094
SMART Domains Protein: ENSMUSP00000039109
Gene: ENSMUSG00000040385

DomainStartEndE-ValueType
PP2Ac 30 300 1.4e-164 SMART
Meta Mutation Damage Score 0.8080 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is highly similar to Schizosaccharomyces pombe rad9, a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair. This protein possesses 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. It forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a knock-out allele are consistently smaller and display abnormal embryonic development and midgestational lethality associated with increased apoptosis and reduced cellular proliferation. Mutant mouse embryonic fibroblasts are not viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 G A 11: 7,111,312 (GRCm39) V868I probably benign Het
Ahnak G T 19: 8,982,269 (GRCm39) M1184I probably damaging Het
Akap11 T C 14: 78,748,928 (GRCm39) E1153G probably damaging Het
Amy1 T C 3: 113,356,376 (GRCm39) N260S probably null Het
Ankrd6 A G 4: 32,824,427 (GRCm39) L129P probably damaging Het
Aox1 A T 1: 58,351,518 (GRCm39) T702S probably benign Het
Apobec1 G T 6: 122,555,845 (GRCm39) T204K possibly damaging Het
Arhgef19 A G 4: 140,976,457 (GRCm39) R433G probably benign Het
Atf6b T A 17: 34,867,618 (GRCm39) H110Q possibly damaging Het
Btnl4 C T 17: 34,694,826 (GRCm39) probably null Het
Camsap2 T C 1: 136,201,521 (GRCm39) T662A possibly damaging Het
Cbs G A 17: 31,843,245 (GRCm39) H229Y probably damaging Het
Cct8 G A 16: 87,287,442 (GRCm39) R111* probably null Het
Cdc42bpb C T 12: 111,293,993 (GRCm39) A250T probably damaging Het
Chrd A G 16: 20,560,097 (GRCm39) probably benign Het
Ckap2l A G 2: 129,117,499 (GRCm39) F559L probably damaging Het
Cltrn A G X: 162,901,230 (GRCm39) D184G possibly damaging Het
D630003M21Rik T C 2: 158,059,477 (GRCm39) Y141C probably damaging Het
Dbf4 T C 5: 8,447,539 (GRCm39) N557S probably benign Het
Dct T G 14: 118,273,935 (GRCm39) N324T probably benign Het
Dip2a A T 10: 76,114,336 (GRCm39) L999* probably null Het
Dock10 T A 1: 80,520,814 (GRCm39) probably null Het
Dync2li1 A T 17: 84,957,225 (GRCm39) D330V probably damaging Het
Eif4g3 T A 4: 137,907,802 (GRCm39) D1267E probably benign Het
Enc1 A G 13: 97,382,486 (GRCm39) E332G possibly damaging Het
Fat2 C T 11: 55,147,606 (GRCm39) V3879I probably benign Het
Fh1 A T 1: 175,444,114 (GRCm39) I117K probably damaging Het
Fkbp15 A G 4: 62,255,328 (GRCm39) L227P probably damaging Het
Fpr1 T A 17: 18,097,315 (GRCm39) M225L probably benign Het
Fras1 A T 5: 96,918,547 (GRCm39) I3528F probably damaging Het
Grm7 A G 6: 111,184,730 (GRCm39) T354A probably benign Het
Ift27 T A 15: 78,057,978 (GRCm39) I9F possibly damaging Het
Igf1r A G 7: 67,844,729 (GRCm39) D834G possibly damaging Het
Igsf9b T A 9: 27,243,028 (GRCm39) L738Q probably damaging Het
Itgam A T 7: 127,663,904 (GRCm39) T44S probably benign Het
Ivd T A 2: 118,692,515 (GRCm39) I5N probably benign Het
Jcad T C 18: 4,675,780 (GRCm39) S1181P probably damaging Het
Kctd18 A G 1: 57,995,524 (GRCm39) V251A probably benign Het
Mycbp2 A G 14: 103,489,945 (GRCm39) V953A possibly damaging Het
Myo18a T C 11: 77,715,923 (GRCm39) probably benign Het
Myo3a A T 2: 22,345,091 (GRCm39) Y509F probably damaging Het
Myocd C A 11: 65,069,496 (GRCm39) M909I probably benign Het
Ndufv3 G A 17: 31,750,219 (GRCm39) R467Q probably damaging Het
Nkpd1 G A 7: 19,257,177 (GRCm39) V319M probably damaging Het
Or13p4 T A 4: 118,547,389 (GRCm39) N87Y probably damaging Het
Or1af1 T C 2: 37,110,344 (GRCm39) V281A probably damaging Het
Or1p1c C T 11: 74,161,043 (GRCm39) A276V probably damaging Het
Or2q1 G T 6: 42,795,202 (GRCm39) A266S possibly damaging Het
Or2t1 T A 14: 14,328,774 (GRCm38) L221Q probably damaging Het
Or4c111 A G 2: 88,843,722 (GRCm39) S229P probably benign Het
Or5b101 C A 19: 13,005,181 (GRCm39) V171L probably benign Het
Parp4 T C 14: 56,827,329 (GRCm39) probably benign Het
Pcdhb9 A G 18: 37,535,871 (GRCm39) T622A probably benign Het
Pdpk1 A T 17: 24,317,150 (GRCm39) probably benign Het
Pkhd1 C A 1: 20,417,681 (GRCm39) G2490V probably damaging Het
Plekhg1 G T 10: 3,853,658 (GRCm39) probably null Het
Plekhh2 A G 17: 84,882,617 (GRCm39) Y708C probably damaging Het
Pnp T C 14: 51,187,786 (GRCm39) F107L probably damaging Het
Postn T A 3: 54,292,708 (GRCm39) probably null Het
Prcp A T 7: 92,577,883 (GRCm39) D349V probably damaging Het
Prl3a1 A T 13: 27,454,177 (GRCm39) I52F probably damaging Het
Pym1 G A 10: 128,601,913 (GRCm39) probably benign Het
Ror2 T G 13: 53,264,341 (GRCm39) E917A probably benign Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sema6d A G 2: 124,501,476 (GRCm39) probably null Het
Shisal1 T C 15: 84,290,669 (GRCm39) T213A probably benign Het
Slc4a2 C T 5: 24,632,618 (GRCm39) A12V probably damaging Het
Slco6b1 T G 1: 96,888,901 (GRCm39) noncoding transcript Het
Slf2 A T 19: 44,923,687 (GRCm39) H167L possibly damaging Het
Snx9 G T 17: 5,970,946 (GRCm39) G429V probably damaging Het
Sod3 G T 5: 52,525,504 (GRCm39) V68L probably benign Het
Spta1 T A 1: 174,074,115 (GRCm39) D2351E probably benign Het
Srpk3 G A X: 72,821,561 (GRCm39) R425Q possibly damaging Het
Tatdn1 C T 15: 58,788,005 (GRCm39) G171E probably damaging Het
Tbc1d22a T C 15: 86,119,770 (GRCm39) V22A possibly damaging Het
Tnfsf9 A G 17: 57,412,738 (GRCm39) T103A probably benign Het
Tpm3-rs7 T C 14: 113,552,595 (GRCm39) L163P possibly damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Ucp1 C T 8: 84,020,661 (GRCm39) T157I probably damaging Het
Uspl1 T A 5: 149,151,224 (GRCm39) L794Q probably benign Het
Vmn1r5 T A 6: 56,962,580 (GRCm39) V85E probably damaging Het
Vmn1r58 A G 7: 5,413,405 (GRCm39) I275T possibly damaging Het
Vmn2r79 A G 7: 86,687,080 (GRCm39) I820M probably damaging Het
Wscd1 C A 11: 71,651,044 (GRCm39) P124T probably benign Het
Zfp780b A T 7: 27,662,525 (GRCm39) C677S possibly damaging Het
Other mutations in Rad9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Rad9a APN 19 4,251,336 (GRCm39) missense probably benign 0.00
R0690:Rad9a UTSW 19 4,247,359 (GRCm39) splice site probably null
R1167:Rad9a UTSW 19 4,247,501 (GRCm39) missense possibly damaging 0.91
R3725:Rad9a UTSW 19 4,247,694 (GRCm39) missense probably damaging 1.00
R4468:Rad9a UTSW 19 4,250,293 (GRCm39) missense probably benign 0.08
R4694:Rad9a UTSW 19 4,250,560 (GRCm39) missense probably damaging 1.00
R4695:Rad9a UTSW 19 4,250,560 (GRCm39) missense probably damaging 1.00
R4742:Rad9a UTSW 19 4,250,560 (GRCm39) missense probably damaging 1.00
R4743:Rad9a UTSW 19 4,250,560 (GRCm39) missense probably damaging 1.00
R4765:Rad9a UTSW 19 4,250,488 (GRCm39) missense probably benign 0.28
R4824:Rad9a UTSW 19 4,250,536 (GRCm39) missense probably benign
R4902:Rad9a UTSW 19 4,251,552 (GRCm39) start gained probably benign
R5037:Rad9a UTSW 19 4,247,173 (GRCm39) missense probably benign 0.00
R5346:Rad9a UTSW 19 4,251,517 (GRCm39) splice site probably null
R7532:Rad9a UTSW 19 4,251,522 (GRCm39) start gained probably benign
R9490:Rad9a UTSW 19 4,247,547 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGCAAGCTCAACCTGAGTG -3'
(R):5'- GTCTTTGAACCAAACACAGGC -3'

Sequencing Primer
(F):5'- CAAGCTCAACCTGAGTGTGTAG -3'
(R):5'- ACAGGCTCTCACTACCTGC -3'
Posted On 2014-06-23