Mutagenetix > Incidental Mutation

Incidental Mutation 'R1824:Cr2'

206635

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

039852-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R1824 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 195157316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 601 (V601A)

Ref Sequence

ENSEMBL: ENSMUSP00000141538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082321
AA Change: V601A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: V601A

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192604

Predicted Effect

probably damaging
Transcript: ENSMUST00000193356
AA Change: V304A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: V304A

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000195120
AA Change: V601A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: V601A

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195737

Predicted Effect

unknown
Transcript: ENSMUST00000210219
AA Change: V977A

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930533K18Rik	T	C	10: 70,872,256		noncoding transcript	Het
9930021J03Rik	T	C	19: 29,716,414	N1960S	probably damaging	Het
Abl1	T	A	2: 31,800,644	M706K	probably benign	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Acd	A	G	8: 105,700,490	L96P	probably damaging	Het
Arsi	T	A	18: 60,912,297	W20R	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asic3	C	T	5: 24,413,751	Q14*	probably null	Het
Asxl3	T	A	18: 22,522,068	I1045N	probably damaging	Het
Atr	T	C	9: 95,936,421	I2149T	probably damaging	Het
Begain	A	G	12: 109,033,099		probably null	Het
Brca2	C	T	5: 150,536,922	T554I	possibly damaging	Het
C130079G13Rik	C	A	3: 59,932,580	Y24*	probably null	Het
C1s2	C	T	6: 124,635,682	V11I	probably benign	Het
Cacna1i	T	C	15: 80,376,789	F1333L	possibly damaging	Het
Camsap2	T	C	1: 136,273,783	T662A	possibly damaging	Het
Cep164	C	T	9: 45,778,928	V1367M	probably damaging	Het
Cfap46	C	A	7: 139,639,602	A1316S	probably benign	Het
Cic	T	C	7: 25,288,266	S553P	probably damaging	Het
Clcn2	C	T	16: 20,715,962	A12T	probably benign	Het
Clip2	A	G	5: 134,503,227	Y540H	probably benign	Het
Coil	A	G	11: 88,982,097	N428S	possibly damaging	Het
Cpxm1	A	C	2: 130,395,697	V196G	probably damaging	Het
Cyp3a25	T	A	5: 145,984,953	K390N	probably damaging	Het
Dclre1a	T	C	19: 56,546,718		probably null	Het
Dennd4a	G	C	9: 64,859,358		probably null	Het
Dlg5	T	C	14: 24,149,444	H1464R	probably benign	Het
Dmac2	T	G	7: 25,624,792	M225R	probably damaging	Het
Dnah8	T	C	17: 30,731,180	V1991A	possibly damaging	Het
Dscam	A	C	16: 96,825,581	V376G	probably benign	Het
Dync1li1	A	G	9: 114,709,184	D203G	probably benign	Het
Eva1c	A	G	16: 90,866,443	T22A	probably benign	Het
Fam110b	A	G	4: 5,799,029	D149G	probably benign	Het
Fras1	A	T	5: 96,770,688	I3528F	probably damaging	Het
Fsip1	T	C	2: 118,232,908	D360G	probably damaging	Het
Galnt14	T	C	17: 73,709,939	T41A	probably benign	Het
Gdf3	T	A	6: 122,609,962	Q2L	probably benign	Het
Glrp1	A	G	1: 88,509,789		probably null	Het
Gm3336	C	G	8: 70,720,417		probably null	Het
Gm8674	C	T	13: 49,900,808		noncoding transcript	Het
Gnat1	A	G	9: 107,676,575	Y226H	probably damaging	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
H1foo	A	G	6: 115,948,758	Y1C	probably null	Het
Ick	T	A	9: 78,157,862	D351E	probably benign	Het
Igfbpl1	C	A	4: 45,826,406	A130S	probably benign	Het
Impdh1	T	A	6: 29,205,088	D261V	probably benign	Het
Itgal	T	A	7: 127,314,060	S610T	probably damaging	Het
Jcad	A	G	18: 4,649,293	T55A	probably benign	Het
Jup	G	A	11: 100,374,137	R663*	probably null	Het
Kalrn	C	T	16: 34,294,215	G556D	probably damaging	Het
Krt81	T	C	15: 101,460,139	E411G	probably damaging	Het
Lcat	T	C	8: 105,939,888	E334G	probably damaging	Het
Lhcgr	T	C	17: 88,750,157	E302G	probably benign	Het
Magi1	A	G	6: 93,699,639	V913A	possibly damaging	Het
Mrpl19	A	T	6: 81,964,079		probably null	Het
Muc4	G	T	16: 32,755,933		probably benign	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo3a	G	A	2: 22,396,243	V600I	probably benign	Het
Ndufv3	G	A	17: 31,531,245	R467Q	probably damaging	Het
Ngef	A	G	1: 87,503,264		probably null	Het
Nisch	A	T	14: 31,176,432		probably benign	Het
Nlrp4c	G	A	7: 6,066,956		probably null	Het
Nup153	A	T	13: 46,713,747	S154T	probably damaging	Het
Obscn	A	G	11: 58,994,832		probably benign	Het
Olfr1247	G	T	2: 89,609,349	P251H	probably damaging	Het
Olfr31	T	A	14: 14,328,774	L221Q	probably damaging	Het
Olfr818	T	C	10: 129,945,337	M242V	possibly damaging	Het
Otogl	T	C	10: 107,779,831	N1869S	probably benign	Het
Phf24	G	T	4: 42,934,661	C136F	probably damaging	Het
Phldb2	A	T	16: 45,826,011	V65E	probably benign	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Prl8a8	A	T	13: 27,508,450	M186K	probably damaging	Het
Qars	T	C	9: 108,514,610	V70A	probably damaging	Het
Rac1	C	T	5: 143,517,225	V14I	probably benign	Het
Rapgef5	T	A	12: 117,688,684		probably null	Het
Slc16a12	G	A	19: 34,670,878	T405M	possibly damaging	Het
Slc17a6	A	G	7: 51,661,546	Y336C	probably damaging	Het
Slc30a9	T	C	5: 67,348,052	L441P	probably damaging	Het
Slc45a2	T	C	15: 11,022,086	S305P	probably damaging	Het
Sod3	G	T	5: 52,368,162	V68L	probably benign	Het
Sp1	T	G	15: 102,431,003	S773A	possibly damaging	Het
Spen	C	A	4: 141,472,785	G2821C	probably damaging	Het
Tagap1	A	G	17: 6,956,026	S424P	probably benign	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Tfec	C	T	6: 16,840,468		probably null	Het
Thsd7a	A	T	6: 12,409,042		probably null	Het
Tnfsf15	C	A	4: 63,733,351	G112V	probably benign	Het
Tnfsf9	A	G	17: 57,105,738	T103A	probably benign	Het
Tnxb	C	T	17: 34,692,333	R1537*	probably null	Het
Tpra1	A	G	6: 88,911,823	N329S	probably benign	Het
Ttc12	A	G	9: 49,456,884	F281S	probably damaging	Het
Unc79	A	G	12: 103,059,320	N322S	probably damaging	Het
Unk	G	T	11: 116,030,442		probably benign	Het
Usp4	G	T	9: 108,348,008	G31W	probably damaging	Het
Vcan	G	T	13: 89,705,212	A543D	possibly damaging	Het
Vil1	A	C	1: 74,418,447	I80L	probably benign	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Vpreb1	A	G	16: 16,869,071		probably null	Het
Zbtb6	C	T	2: 37,429,817	C33Y	probably damaging	Het
Zfp330	A	T	8: 82,766,015	C189*	probably null	Het
Zfp942	T	A	17: 21,928,541	H369L	probably damaging	Het
Zfp943	T	A	17: 21,992,380	I149K	probably benign	Het
Zfyve19	G	A	2: 119,211,535	V162M	probably benign	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GGCACCAAATTTTATCTCCAGC -3'
(R):5'- GGAGTTCCTCAGAAGATGTCCC -3'

Sequencing Primer
(F):5'- AAATTTTATCTCCAGCCCCTCAATTC -3'
(R):5'- GTTCCTCAGAAGATGTCCCATATGG -3'

Posted On

2014-06-23