Incidental Mutation 'R1824:Slc45a2'
ID206713
Institutional Source Beutler Lab
Gene Symbol Slc45a2
Ensembl Gene ENSMUSG00000022243
Gene Namesolute carrier family 45, member 2
Synonymsblanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
MMRRC Submission 039852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1824 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location11000721-11029233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11022086 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 305 (S305P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117100]
Predicted Effect probably damaging
Transcript: ENSMUST00000022851
AA Change: S305P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022851
Gene: ENSMUSG00000022243
AA Change: S305P

DomainStartEndE-ValueType
Pfam:MFS_2 34 262 2.4e-17 PFAM
Pfam:MFS_1 36 363 3e-13 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117100
AA Change: S305P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112408
Gene: ENSMUSG00000022243
AA Change: S305P

DomainStartEndE-ValueType
Pfam:MFS_2 1 457 2e-22 PFAM
Pfam:MFS_1 2 292 2.6e-12 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,872,256 noncoding transcript Het
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abl1 T A 2: 31,800,644 M706K probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Acd A G 8: 105,700,490 L96P probably damaging Het
Arsi T A 18: 60,912,297 W20R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asic3 C T 5: 24,413,751 Q14* probably null Het
Asxl3 T A 18: 22,522,068 I1045N probably damaging Het
Atr T C 9: 95,936,421 I2149T probably damaging Het
Begain A G 12: 109,033,099 probably null Het
Brca2 C T 5: 150,536,922 T554I possibly damaging Het
C130079G13Rik C A 3: 59,932,580 Y24* probably null Het
C1s2 C T 6: 124,635,682 V11I probably benign Het
Cacna1i T C 15: 80,376,789 F1333L possibly damaging Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cep164 C T 9: 45,778,928 V1367M probably damaging Het
Cfap46 C A 7: 139,639,602 A1316S probably benign Het
Cic T C 7: 25,288,266 S553P probably damaging Het
Clcn2 C T 16: 20,715,962 A12T probably benign Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Coil A G 11: 88,982,097 N428S possibly damaging Het
Cpxm1 A C 2: 130,395,697 V196G probably damaging Het
Cr2 A G 1: 195,157,316 V601A probably damaging Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Dclre1a T C 19: 56,546,718 probably null Het
Dennd4a G C 9: 64,859,358 probably null Het
Dlg5 T C 14: 24,149,444 H1464R probably benign Het
Dmac2 T G 7: 25,624,792 M225R probably damaging Het
Dnah8 T C 17: 30,731,180 V1991A possibly damaging Het
Dscam A C 16: 96,825,581 V376G probably benign Het
Dync1li1 A G 9: 114,709,184 D203G probably benign Het
Eva1c A G 16: 90,866,443 T22A probably benign Het
Fam110b A G 4: 5,799,029 D149G probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Fsip1 T C 2: 118,232,908 D360G probably damaging Het
Galnt14 T C 17: 73,709,939 T41A probably benign Het
Gdf3 T A 6: 122,609,962 Q2L probably benign Het
Glrp1 A G 1: 88,509,789 probably null Het
Gm3336 C G 8: 70,720,417 probably null Het
Gm8674 C T 13: 49,900,808 noncoding transcript Het
Gnat1 A G 9: 107,676,575 Y226H probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H1foo A G 6: 115,948,758 Y1C probably null Het
Ick T A 9: 78,157,862 D351E probably benign Het
Igfbpl1 C A 4: 45,826,406 A130S probably benign Het
Impdh1 T A 6: 29,205,088 D261V probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jcad A G 18: 4,649,293 T55A probably benign Het
Jup G A 11: 100,374,137 R663* probably null Het
Kalrn C T 16: 34,294,215 G556D probably damaging Het
Krt81 T C 15: 101,460,139 E411G probably damaging Het
Lcat T C 8: 105,939,888 E334G probably damaging Het
Lhcgr T C 17: 88,750,157 E302G probably benign Het
Magi1 A G 6: 93,699,639 V913A possibly damaging Het
Mrpl19 A T 6: 81,964,079 probably null Het
Muc4 G T 16: 32,755,933 probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a G A 2: 22,396,243 V600I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Ngef A G 1: 87,503,264 probably null Het
Nisch A T 14: 31,176,432 probably benign Het
Nlrp4c G A 7: 6,066,956 probably null Het
Nup153 A T 13: 46,713,747 S154T probably damaging Het
Obscn A G 11: 58,994,832 probably benign Het
Olfr1247 G T 2: 89,609,349 P251H probably damaging Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr818 T C 10: 129,945,337 M242V possibly damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Phf24 G T 4: 42,934,661 C136F probably damaging Het
Phldb2 A T 16: 45,826,011 V65E probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prl8a8 A T 13: 27,508,450 M186K probably damaging Het
Qars T C 9: 108,514,610 V70A probably damaging Het
Rac1 C T 5: 143,517,225 V14I probably benign Het
Rapgef5 T A 12: 117,688,684 probably null Het
Slc16a12 G A 19: 34,670,878 T405M possibly damaging Het
Slc17a6 A G 7: 51,661,546 Y336C probably damaging Het
Slc30a9 T C 5: 67,348,052 L441P probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Sp1 T G 15: 102,431,003 S773A possibly damaging Het
Spen C A 4: 141,472,785 G2821C probably damaging Het
Tagap1 A G 17: 6,956,026 S424P probably benign Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tfec C T 6: 16,840,468 probably null Het
Thsd7a A T 6: 12,409,042 probably null Het
Tnfsf15 C A 4: 63,733,351 G112V probably benign Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tnxb C T 17: 34,692,333 R1537* probably null Het
Tpra1 A G 6: 88,911,823 N329S probably benign Het
Ttc12 A G 9: 49,456,884 F281S probably damaging Het
Unc79 A G 12: 103,059,320 N322S probably damaging Het
Unk G T 11: 116,030,442 probably benign Het
Usp4 G T 9: 108,348,008 G31W probably damaging Het
Vcan G T 13: 89,705,212 A543D possibly damaging Het
Vil1 A C 1: 74,418,447 I80L probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Vpreb1 A G 16: 16,869,071 probably null Het
Zbtb6 C T 2: 37,429,817 C33Y probably damaging Het
Zfp330 A T 8: 82,766,015 C189* probably null Het
Zfp942 T A 17: 21,928,541 H369L probably damaging Het
Zfp943 T A 17: 21,992,380 I149K probably benign Het
Zfyve19 G A 2: 119,211,535 V162M probably benign Het
Other mutations in Slc45a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 start codon destroyed probably null 0.80
IGL02283:Slc45a2 APN 15 11001182 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023354 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012687 missense probably benign
IGL03123:Slc45a2 APN 15 11012655 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022192 missense probably damaging 1.00
cardigan UTSW 15 11022172 synonymous probably benign
cheng UTSW 15 11025868 missense probably damaging 0.99
Draco2 UTSW 15 11000817 start codon destroyed probably benign 0.05
galak UTSW 15 11012667 missense probably benign
goku UTSW 15 11000855 nonsense probably null
grey_goose UTSW 15 11002981 missense probably damaging 1.00
june_gloom UTSW 15 11023443 missense possibly damaging 0.94
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
sweater UTSW 15 11012610 missense probably damaging 1.00
voldemort UTSW 15 unclassified
yuki UTSW 15 11001092 missense probably damaging 1.00
zuckerkuss UTSW 15 11025935 critical splice donor site probably benign
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025746 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022128 missense probably null 0.01
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012714 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012576 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11027930 nonsense probably null
R4990:Slc45a2 UTSW 15 11001150 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012607 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5210:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5500:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012607 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022083 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001133 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000855 nonsense probably null
R6236:Slc45a2 UTSW 15 11022072 missense probably benign 0.00
R6709:Slc45a2 UTSW 15 11001130 missense possibly damaging 0.46
R7243:Slc45a2 UTSW 15 11023350 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGGGAGTTGAATAGCAATCTGTG -3'
(R):5'- ATCTATTGCACAGGCCAGAC -3'

Sequencing Primer
(F):5'- CATCACACAGTTGTAGTGGTCAG -3'
(R):5'- CAAGAGTGTGGGCATATGCATCC -3'
Posted On2014-06-23