Mutagenetix > Incidental Mutation

Incidental Mutation 'R0114:Ppm1d'

20673

Institutional Source

Beutler Lab

Gene Symbol

Ppm1d

Ensembl Gene

ENSMUSG00000020525

Gene Name

protein phosphatase 1D magnesium-dependent, delta isoform

Synonyms

Wip1

MMRRC Submission

038400-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0114 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

85311244-85347066 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 85326905 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 20 (G20R)

Ref Sequence

ENSEMBL: ENSMUSP00000115606 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020835] [ENSMUST00000127717]

AlphaFold

Q9QZ67

Predicted Effect

probably damaging
Transcript: ENSMUST00000020835
AA Change: G165R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: G165R

Domain	Start	End	E-Value	Type
PP2Cc	1	366	1.4e-76	SMART
PP2C_SIG	78	368	6.09e0	SMART
low complexity region	403	415	N/A	INTRINSIC
Blast:PP2Cc	416	476	1e-19	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000127717
AA Change: G20R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115606
Gene: ENSMUSG00000020525
AA Change: G20R

Domain	Start	End	E-Value	Type
PP2Cc	1	170	2.87e-5	SMART

Meta Mutation Damage Score

0.9749

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 93.2%
20x: 79.2%

Validation Efficiency

100% (99/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	C	10: 28,985,982		probably benign	Het
4933427D14Rik	T	C	11: 72,195,799	Y262C	probably damaging	Het
Adamts1	C	A	16: 85,799,614	V379L	probably benign	Het
Akt3	T	C	1: 177,067,251	D260G	probably damaging	Het
Alms1	T	C	6: 85,619,803	L537P	probably benign	Het
Anln	A	T	9: 22,353,346	I876N	probably damaging	Het
Ano9	A	T	7: 141,103,239		probably benign	Het
Arhgef10l	T	C	4: 140,583,883	E218G	probably benign	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Atp9a	G	T	2: 168,710,856	Y63*	probably null	Het
Bmpr2	G	T	1: 59,815,340	C116F	probably damaging	Het
Cand1	T	C	10: 119,216,522	D233G	probably benign	Het
Cftr	A	T	6: 18,282,448	H1049L	probably damaging	Het
Ckap5	A	T	2: 91,620,112	D1975V	possibly damaging	Het
Cyp26c1	T	C	19: 37,686,633	V134A	probably benign	Het
Dnaic1	T	C	4: 41,605,686		probably benign	Het
Dpp10	T	C	1: 123,486,092	I163V	probably benign	Het
Fam151a	A	T	4: 106,734,004	I15F	possibly damaging	Het
Fanca	A	T	8: 123,288,491		probably null	Het
Fes	A	G	7: 80,378,035	V787A	probably damaging	Het
Fnip1	C	T	11: 54,487,801		probably benign	Het
Gabpb1	A	G	2: 126,653,574	I86T	probably damaging	Het
Gm1840	A	G	8: 5,640,359		noncoding transcript	Het
Gmds	A	T	13: 32,227,281	S57T	probably benign	Het
Gnpat	T	G	8: 124,883,357	D426E	probably benign	Het
Gnptab	C	A	10: 88,433,400	P655Q	possibly damaging	Het
Herc1	T	A	9: 66,461,846	F2941I	probably damaging	Het
Herc2	T	C	7: 56,153,774		probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Itga11	T	C	9: 62,760,302	V639A	possibly damaging	Het
Itga11	T	G	9: 62,735,293	V166G	probably damaging	Het
Itpr2	A	G	6: 146,312,879	F1490S	probably damaging	Het
Lama2	C	A	10: 26,993,068	E802*	probably null	Het
Lgi3	C	T	14: 70,531,029		probably benign	Het
Limch1	C	T	5: 67,036,084		probably benign	Het
Lipc	T	C	9: 70,803,781	N363S	probably damaging	Het
Lrit2	A	G	14: 37,068,045		probably null	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mug2	A	G	6: 122,040,648	Y448C	probably damaging	Het
Mybpc3	A	G	2: 91,124,494	E450G	probably damaging	Het
Myo5b	A	T	18: 74,742,171	T1549S	probably benign	Het
Naa15	T	C	3: 51,448,438		probably null	Het
Nckap1l	T	A	15: 103,455,028	C54S	probably benign	Het
Nlrp9b	A	G	7: 20,024,056	D406G	probably benign	Het
Nprl3	T	A	11: 32,239,784		probably benign	Het
Nvl	A	G	1: 181,120,391	V429A	probably benign	Het
Olfr114	A	T	17: 37,589,415	*313K	probably null	Het
Olfr54	G	A	11: 51,027,604	V201I	probably benign	Het
Olfr548-ps1	A	T	7: 102,542,731	Q265L	probably benign	Het
Olfr801	T	A	10: 129,669,598	Y307F	probably benign	Het
Opa1	A	T	16: 29,629,635	N912Y	probably benign	Het
Pcnx	T	C	12: 81,996,095	V2317A	possibly damaging	Het
Phf3	A	T	1: 30,805,443	N1478K	possibly damaging	Het
Phykpl	G	A	11: 51,586,653	D91N	probably benign	Het
Polr2b	T	A	5: 77,343,263	C984S	probably damaging	Het
Ppfibp1	A	G	6: 146,998,233	R141G	probably benign	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppp2r5b	C	A	19: 6,228,431	V483F	probably benign	Het
Ppp4r4	T	A	12: 103,576,374	C132S	probably benign	Het
Prg2	A	G	2: 84,983,456		probably benign	Het
Prpf4b	G	A	13: 34,890,488		probably benign	Het
Rad54l2	T	C	9: 106,713,455	T491A	probably damaging	Het
Rnf213	G	T	11: 119,414,587	W548L	probably damaging	Het
Rusc2	G	T	4: 43,422,055	C825F	probably damaging	Het
Sema4b	A	G	7: 80,219,078		probably benign	Het
Sema6a	A	G	18: 47,290,177	V254A	probably damaging	Het
Slc13a3	A	G	2: 165,424,581	F346L	probably damaging	Het
Slc25a17	T	C	15: 81,337,959	D104G	probably damaging	Het
Specc1	A	T	11: 62,146,313	N707Y	possibly damaging	Het
Tex48	T	A	4: 63,608,459	E76V	probably damaging	Het
Tfr2	T	C	5: 137,577,465	V281A	probably benign	Het
Tgfb1i1	A	C	7: 128,249,494	Q238H	probably damaging	Het
Thoc6	G	A	17: 23,670,239	T122I	probably benign	Het
Tmtc1	G	A	6: 148,412,830		probably benign	Het
Tnfrsf8	T	C	4: 145,288,047	D264G	possibly damaging	Het
Trim43a	T	A	9: 88,584,160	I178N	probably damaging	Het
Ttn	G	C	2: 76,707,093	I26503M	possibly damaging	Het
Usp28	C	A	9: 49,039,023	D589E	probably benign	Het
Utp23	T	C	15: 51,882,511	S242P	probably damaging	Het
Vwa3a	A	G	7: 120,775,380	Y305C	probably benign	Het
Vwa5b1	C	A	4: 138,608,858	E142*	probably null	Het
Xrn2	A	T	2: 147,029,779	T374S	probably damaging	Het
Zfp735	A	T	11: 73,710,662	Q144L	probably benign	Het

Other mutations in Ppm1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02095:Ppm1d	APN	11	85327006	missense	probably benign	0.04
IGL02351:Ppm1d	APN	11	85345715	missense	probably damaging	0.99
IGL02358:Ppm1d	APN	11	85345715	missense	probably damaging	0.99
IGL02496:Ppm1d	APN	11	85339666	missense	possibly damaging	0.51
IGL02667:Ppm1d	APN	11	85332285	missense	probably damaging	1.00
IGL02885:Ppm1d	APN	11	85326944	missense	possibly damaging	0.52
IGL03085:Ppm1d	APN	11	85337163	missense	probably null	0.80
R0606:Ppm1d	UTSW	11	85345877	missense	probably benign	0.27
R1014:Ppm1d	UTSW	11	85337154	missense	probably damaging	0.98
R1548:Ppm1d	UTSW	11	85339605	missense	probably damaging	1.00
R3774:Ppm1d	UTSW	11	85337167	missense	probably damaging	1.00
R3775:Ppm1d	UTSW	11	85337167	missense	probably damaging	1.00
R4025:Ppm1d	UTSW	11	85345757	missense	probably benign	0.09
R4065:Ppm1d	UTSW	11	85345852	missense	probably benign	0.01
R4067:Ppm1d	UTSW	11	85345852	missense	probably benign	0.01
R4118:Ppm1d	UTSW	11	85311582	missense	probably benign	0.01
R5169:Ppm1d	UTSW	11	85332370	missense	probably damaging	1.00
R5384:Ppm1d	UTSW	11	85311783	missense	probably damaging	0.98
R5861:Ppm1d	UTSW	11	85311848	missense	possibly damaging	0.70
R5890:Ppm1d	UTSW	11	85326908	missense	probably damaging	1.00
R6394:Ppm1d	UTSW	11	85339672	missense	probably benign
R6992:Ppm1d	UTSW	11	85332352	missense	probably damaging	1.00
R7006:Ppm1d	UTSW	11	85337151	missense	possibly damaging	0.92
R7297:Ppm1d	UTSW	11	85345995	missense	probably damaging	1.00
R7993:Ppm1d	UTSW	11	85326951	missense	probably damaging	1.00
R8099:Ppm1d	UTSW	11	85339666	missense	possibly damaging	0.51
R8697:Ppm1d	UTSW	11	85337160	missense	possibly damaging	0.95
R8738:Ppm1d	UTSW	11	85345906	missense	probably damaging	0.99
R9018:Ppm1d	UTSW	11	85337135	missense	probably damaging	0.98
R9188:Ppm1d	UTSW	11	85345921	missense	possibly damaging	0.93
Z1176:Ppm1d	UTSW	11	85339573	missense	probably benign	0.09
Z1177:Ppm1d	UTSW	11	85326963	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- agaaaccctacctcagccaAGTCG -3'
(R):5'- AATGATCACCTGCCGCCAAGTC -3'

Sequencing Primer
(F):5'- ACCTCCCTCCAGTTCAAGATG -3'
(R):5'- TGCCGCCAAGTCCTTCG -3'

Posted On

2013-04-11