Incidental Mutation 'R1826:Baz2b'
ID 206751
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Name bromodomain adjacent to zinc finger domain, 2B
Synonyms D2Ertd794e, 5830435C13Rik
MMRRC Submission 039853-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R1826 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 59729707-60040183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59799077 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 349 (E349G)
Ref Sequence ENSEMBL: ENSMUSP00000108169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
AlphaFold A2AUY4
Predicted Effect probably benign
Transcript: ENSMUST00000090925
AA Change: E349G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: E349G

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112550
AA Change: E349G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: E349G

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Meta Mutation Damage Score 0.1083 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 95% (116/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,810,453 (GRCm39) S917P probably benign Het
Acsbg1 C T 9: 54,529,840 (GRCm39) V256M possibly damaging Het
Adam34 T A 8: 44,104,379 (GRCm39) D422V probably damaging Het
Adam6a T A 12: 113,509,742 (GRCm39) V705E possibly damaging Het
Adamts12 C A 15: 11,071,606 (GRCm39) P50Q probably benign Het
Arfgap3 C T 15: 83,187,303 (GRCm39) probably null Het
Aspg T A 12: 112,089,852 (GRCm39) D463E probably damaging Het
Atad2b G A 12: 5,024,094 (GRCm39) S73N probably benign Het
Atp11a T C 8: 12,896,154 (GRCm39) L788P probably damaging Het
B3gnt8 T C 7: 25,328,188 (GRCm39) F206S probably damaging Het
Bmp2k A T 5: 97,209,261 (GRCm39) probably benign Het
Camta2 A G 11: 70,574,134 (GRCm39) F128L probably damaging Het
Ccdc88a A T 11: 29,439,637 (GRCm39) Q30L possibly damaging Het
Cdh1 T C 8: 107,392,898 (GRCm39) M794T probably benign Het
Cdh5 A G 8: 104,857,723 (GRCm39) N383S possibly damaging Het
Cep85l T C 10: 53,224,908 (GRCm39) D227G possibly damaging Het
Clec4e A G 6: 123,260,591 (GRCm39) S156P probably damaging Het
Col10a1 G T 10: 34,270,645 (GRCm39) G206C probably damaging Het
Col4a2 T C 8: 11,363,509 (GRCm39) probably null Het
Copg2 A G 6: 30,789,777 (GRCm39) M517T probably benign Het
Cyp2f2 T A 7: 26,831,987 (GRCm39) L414Q probably damaging Het
Dact1 G A 12: 71,365,118 (GRCm39) G596D probably damaging Het
Dcaf13 T C 15: 38,982,294 (GRCm39) C87R probably damaging Het
Dchs1 T G 7: 105,406,834 (GRCm39) T2224P probably damaging Het
Dnah12 A G 14: 26,432,174 (GRCm39) M429V probably benign Het
Dppa2 G A 16: 48,137,711 (GRCm39) R231H probably damaging Het
Elavl4 T C 4: 110,108,489 (GRCm39) D78G probably damaging Het
Enthd1 T C 15: 80,358,482 (GRCm39) E346G probably damaging Het
Exoc3l A T 8: 106,020,250 (GRCm39) I225N probably damaging Het
Fasn C T 11: 120,699,325 (GRCm39) probably benign Het
Fbxl7 G A 15: 26,552,851 (GRCm39) R139C possibly damaging Het
Fbxw15 C A 9: 109,388,782 (GRCm39) probably null Het
Flnc A G 6: 29,455,184 (GRCm39) T1971A probably damaging Het
Fnip1 T G 11: 54,356,990 (GRCm39) V33G probably damaging Het
Foxn2 A G 17: 88,794,233 (GRCm39) E390G possibly damaging Het
Fry C T 5: 150,360,174 (GRCm39) S1940L possibly damaging Het
Fzd3 A T 14: 65,490,555 (GRCm39) D9E probably benign Het
Gabrd T C 4: 155,470,943 (GRCm39) Y255C probably damaging Het
Garem1 A T 18: 21,262,509 (GRCm39) F768L probably benign Het
Gas2 T A 7: 51,593,421 (GRCm39) L167Q probably damaging Het
Gm16391 A G 17: 76,591,418 (GRCm39) noncoding transcript Het
Gm1979 A T 5: 26,206,240 (GRCm39) N113K probably damaging Het
Gpr83 G T 9: 14,779,629 (GRCm39) C269F possibly damaging Het
Hdac4 T A 1: 91,912,421 (GRCm39) N352Y probably damaging Het
Hdac9 A G 12: 34,479,491 (GRCm39) probably benign Het
Hhipl2 G A 1: 183,217,253 (GRCm39) S673N probably benign Het
Iffo2 T A 4: 139,341,376 (GRCm39) S417T probably benign Het
Itgb5 G T 16: 33,685,930 (GRCm39) R90L possibly damaging Het
Jade1 T G 3: 41,567,648 (GRCm39) L572W probably damaging Het
Kcnh1 T A 1: 192,095,376 (GRCm39) M478K possibly damaging Het
Kcnma1 C A 14: 23,380,997 (GRCm39) D903Y probably damaging Het
Kcnq4 T A 4: 120,561,701 (GRCm39) H456L probably benign Het
Kif9 C A 9: 110,346,701 (GRCm39) T613K probably benign Het
Krt36 T G 11: 99,993,856 (GRCm39) probably benign Het
Kyat3 A T 3: 142,428,940 (GRCm39) D89V possibly damaging Het
Lnpep A T 17: 17,783,098 (GRCm39) F568I probably damaging Het
Lpl T C 8: 69,354,943 (GRCm39) F444L possibly damaging Het
Lrp1 A T 10: 127,389,576 (GRCm39) V3153E probably damaging Het
Lrrn1 A T 6: 107,544,529 (GRCm39) N109I probably benign Het
Ltn1 A G 16: 87,212,504 (GRCm39) Y686H probably damaging Het
Mcoln2 A C 3: 145,881,227 (GRCm39) D166A possibly damaging Het
Ms4a6b A T 19: 11,501,298 (GRCm39) I103F probably damaging Het
Mtmr10 T G 7: 63,987,214 (GRCm39) S585A probably benign Het
Mx1 T C 16: 97,256,837 (GRCm39) N114S possibly damaging Het
Mysm1 A T 4: 94,858,923 (GRCm39) N75K probably benign Het
Nkx1-1 A G 5: 33,591,277 (GRCm39) V15A unknown Het
Nlrp1a G A 11: 71,013,573 (GRCm39) T559I possibly damaging Het
Nlrp1a T A 11: 70,998,806 (GRCm39) probably benign Het
Oas1f A G 5: 120,993,652 (GRCm39) K288R probably benign Het
Or10q1 T A 19: 13,726,711 (GRCm39) D80E probably benign Het
Or55b3 A G 7: 102,126,720 (GRCm39) L119P probably damaging Het
Or9e1 T A 11: 58,732,257 (GRCm39) C106S probably benign Het
Pcdhb2 T A 18: 37,429,038 (GRCm39) V337D probably damaging Het
Pcdhb5 C T 18: 37,454,522 (GRCm39) R301* probably null Het
Phf12 T C 11: 77,915,780 (GRCm39) probably benign Het
Pik3c2a C T 7: 115,967,352 (GRCm39) D862N probably benign Het
Pkhd1l1 T A 15: 44,366,741 (GRCm39) L740I possibly damaging Het
Ppp1r9a A T 6: 5,111,060 (GRCm39) probably benign Het
Prg4 T C 1: 150,327,760 (GRCm39) D820G probably benign Het
Prmt9 C T 8: 78,282,303 (GRCm39) Q67* probably null Het
Prob1 T C 18: 35,786,628 (GRCm39) E542G possibly damaging Het
Pttg1 A G 11: 43,311,193 (GRCm39) V188A probably damaging Het
Rassf1 T A 9: 107,435,392 (GRCm39) L260H probably damaging Het
Rbm5 T A 9: 107,619,613 (GRCm39) Q766L probably damaging Het
Rbms3 T A 9: 116,651,936 (GRCm39) Y137F probably damaging Het
Rccd1 T C 7: 79,969,966 (GRCm39) probably benign Het
Rnf182 G A 13: 43,822,010 (GRCm39) W187* probably null Het
S100a11 A T 3: 93,433,428 (GRCm39) I91F probably benign Het
Setd4 T A 16: 93,388,187 (GRCm39) K100* probably null Het
Simc1 T A 13: 54,672,452 (GRCm39) C267S probably benign Het
Slc16a1 G T 3: 104,558,255 (GRCm39) A91S probably benign Het
Slc36a1 A G 11: 55,111,279 (GRCm39) N133S probably benign Het
Ssxb16 T A X: 8,746,944 (GRCm39) Y133* probably null Het
Svil C T 18: 5,063,383 (GRCm39) P885S probably benign Het
Svop A T 5: 114,198,117 (GRCm39) probably null Het
Taar7d T C 10: 23,903,474 (GRCm39) Y119H probably damaging Het
Tasor2 T A 13: 3,631,759 (GRCm39) N914I probably damaging Het
Tgfb3 T C 12: 86,108,818 (GRCm39) T304A probably benign Het
Tmem94 C A 11: 115,684,039 (GRCm39) C786* probably null Het
Tnfrsf4 T A 4: 156,100,736 (GRCm39) probably null Het
Tns1 C A 1: 73,992,793 (GRCm39) M1I probably null Het
Trappc13 C T 13: 104,306,327 (GRCm39) probably null Het
Trim72 T C 7: 127,607,016 (GRCm39) F182L possibly damaging Het
Ttc6 T C 12: 57,707,033 (GRCm39) S647P probably benign Het
Tulp1 A G 17: 28,575,341 (GRCm39) L400P possibly damaging Het
Vegfc C T 8: 54,634,347 (GRCm39) T342M possibly damaging Het
Vit T A 17: 78,842,105 (GRCm39) V15E probably benign Het
Vps13d A T 4: 144,881,573 (GRCm39) M1334K probably damaging Het
Zfp280d T C 9: 72,206,062 (GRCm39) V23A probably damaging Het
Zfp608 A G 18: 55,031,648 (GRCm39) I764T probably benign Het
Zfp94 T C 7: 24,008,540 (GRCm39) Y33C probably damaging Het
Zfyve26 T A 12: 79,315,823 (GRCm39) I1218F probably damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59,743,139 (GRCm39) missense probably benign 0.02
IGL00476:Baz2b APN 2 59,744,083 (GRCm39) missense probably benign 0.06
IGL00489:Baz2b APN 2 59,788,019 (GRCm39) nonsense probably null
IGL00514:Baz2b APN 2 59,792,821 (GRCm39) missense probably benign 0.11
IGL00678:Baz2b APN 2 59,836,527 (GRCm39) missense unknown
IGL01348:Baz2b APN 2 59,764,031 (GRCm39) missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59,799,233 (GRCm39) missense probably benign 0.18
IGL01924:Baz2b APN 2 59,765,615 (GRCm39) missense probably damaging 1.00
IGL02125:Baz2b APN 2 59,798,984 (GRCm39) missense probably benign 0.12
IGL02314:Baz2b APN 2 59,792,571 (GRCm39) missense probably benign
IGL02370:Baz2b APN 2 59,753,933 (GRCm39) missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59,790,407 (GRCm39) missense probably benign 0.40
IGL02499:Baz2b APN 2 59,731,840 (GRCm39) missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59,747,713 (GRCm39) missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59,778,604 (GRCm39) missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59,747,849 (GRCm39) unclassified probably benign
IGL02716:Baz2b APN 2 59,792,868 (GRCm39) missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59,807,718 (GRCm39) missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59,799,002 (GRCm39) missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59,807,872 (GRCm39) missense probably benign 0.00
IGL02886:Baz2b APN 2 59,788,087 (GRCm39) splice site probably null
IGL02892:Baz2b APN 2 59,731,080 (GRCm39) missense probably damaging 1.00
IGL03132:Baz2b APN 2 59,738,097 (GRCm39) splice site probably benign
IGL03183:Baz2b APN 2 59,733,640 (GRCm39) missense probably benign 0.10
IGL03197:Baz2b APN 2 59,731,898 (GRCm39) missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0122:Baz2b UTSW 2 59,743,963 (GRCm39) splice site probably null
R0136:Baz2b UTSW 2 59,732,298 (GRCm39) missense probably benign 0.22
R0144:Baz2b UTSW 2 59,737,839 (GRCm39) missense probably damaging 0.98
R0403:Baz2b UTSW 2 59,799,721 (GRCm39) missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59,732,340 (GRCm39) unclassified probably benign
R0528:Baz2b UTSW 2 59,767,083 (GRCm39) missense probably damaging 1.00
R1025:Baz2b UTSW 2 59,792,826 (GRCm39) missense probably benign 0.06
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59,752,553 (GRCm39) missense probably damaging 1.00
R1511:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R1514:Baz2b UTSW 2 59,792,670 (GRCm39) missense probably benign 0.13
R1519:Baz2b UTSW 2 59,778,598 (GRCm39) missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59,798,981 (GRCm39) missense possibly damaging 0.47
R1630:Baz2b UTSW 2 59,836,474 (GRCm39) missense unknown
R1641:Baz2b UTSW 2 59,743,234 (GRCm39) missense probably damaging 0.99
R1674:Baz2b UTSW 2 59,743,336 (GRCm39) missense possibly damaging 0.53
R1778:Baz2b UTSW 2 59,836,480 (GRCm39) missense unknown
R1835:Baz2b UTSW 2 59,732,163 (GRCm39) missense probably benign 0.02
R1954:Baz2b UTSW 2 59,799,087 (GRCm39) missense probably benign 0.12
R1981:Baz2b UTSW 2 59,754,024 (GRCm39) missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59,743,067 (GRCm39) unclassified probably benign
R2567:Baz2b UTSW 2 59,744,255 (GRCm39) missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59,743,348 (GRCm39) missense probably benign 0.27
R2848:Baz2b UTSW 2 59,755,010 (GRCm39) missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59,799,240 (GRCm39) missense probably benign 0.12
R3935:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59,742,917 (GRCm39) splice site probably null
R4182:Baz2b UTSW 2 59,928,801 (GRCm39) intron probably benign
R4255:Baz2b UTSW 2 59,750,916 (GRCm39) unclassified probably benign
R4359:Baz2b UTSW 2 59,731,957 (GRCm39) missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59,799,599 (GRCm39) missense probably benign 0.06
R4743:Baz2b UTSW 2 59,744,255 (GRCm39) missense probably benign 0.01
R4772:Baz2b UTSW 2 59,788,795 (GRCm39) missense probably damaging 0.96
R4858:Baz2b UTSW 2 59,738,087 (GRCm39) missense probably benign
R4868:Baz2b UTSW 2 59,755,226 (GRCm39) missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59,773,103 (GRCm39) splice site probably null
R4889:Baz2b UTSW 2 59,767,070 (GRCm39) missense probably damaging 1.00
R4890:Baz2b UTSW 2 59,756,383 (GRCm39) missense probably damaging 0.99
R4914:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R5027:Baz2b UTSW 2 59,928,988 (GRCm39) intron probably benign
R5031:Baz2b UTSW 2 59,743,151 (GRCm39) missense probably benign 0.00
R5082:Baz2b UTSW 2 59,731,835 (GRCm39) nonsense probably null
R5133:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R5276:Baz2b UTSW 2 59,792,958 (GRCm39) missense probably benign 0.40
R5279:Baz2b UTSW 2 59,762,496 (GRCm39) missense probably damaging 1.00
R5294:Baz2b UTSW 2 59,808,946 (GRCm39) missense probably benign 0.11
R5447:Baz2b UTSW 2 59,744,332 (GRCm39) missense probably damaging 0.99
R5903:Baz2b UTSW 2 59,790,233 (GRCm39) missense probably damaging 0.99
R5910:Baz2b UTSW 2 59,807,770 (GRCm39) missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59,742,871 (GRCm39) missense probably damaging 0.99
R6195:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59,809,019 (GRCm39) missense probably benign 0.00
R6208:Baz2b UTSW 2 59,755,150 (GRCm39) missense probably damaging 1.00
R6233:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59,778,567 (GRCm39) missense probably damaging 1.00
R6324:Baz2b UTSW 2 59,737,292 (GRCm39) missense probably damaging 1.00
R6490:Baz2b UTSW 2 59,732,073 (GRCm39) missense probably damaging 1.00
R6578:Baz2b UTSW 2 59,799,623 (GRCm39) missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59,755,234 (GRCm39) missense probably damaging 1.00
R6760:Baz2b UTSW 2 59,792,776 (GRCm39) missense probably benign 0.40
R6836:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R6859:Baz2b UTSW 2 59,731,874 (GRCm39) missense probably benign 0.01
R6880:Baz2b UTSW 2 59,743,283 (GRCm39) missense probably damaging 0.99
R6916:Baz2b UTSW 2 59,799,120 (GRCm39) missense probably benign
R6978:Baz2b UTSW 2 59,738,059 (GRCm39) missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59,764,014 (GRCm39) critical splice donor site probably null
R7112:Baz2b UTSW 2 59,792,528 (GRCm39) missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59,742,841 (GRCm39) missense
R7198:Baz2b UTSW 2 59,792,550 (GRCm39) missense probably benign 0.00
R7270:Baz2b UTSW 2 59,792,836 (GRCm39) missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59,750,781 (GRCm39) missense probably benign 0.17
R7464:Baz2b UTSW 2 59,807,792 (GRCm39) missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59,792,817 (GRCm39) missense probably benign 0.40
R7703:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R7850:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7851:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7988:Baz2b UTSW 2 59,792,485 (GRCm39) missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59,731,112 (GRCm39) missense probably damaging 1.00
R8084:Baz2b UTSW 2 59,792,580 (GRCm39) missense probably benign
R8343:Baz2b UTSW 2 59,731,858 (GRCm39) missense probably damaging 1.00
R8348:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8438:Baz2b UTSW 2 59,747,828 (GRCm39) nonsense probably null
R8448:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8511:Baz2b UTSW 2 59,732,158 (GRCm39) missense probably benign
R8893:Baz2b UTSW 2 59,755,149 (GRCm39) missense probably damaging 0.96
R8947:Baz2b UTSW 2 59,778,583 (GRCm39) missense probably benign 0.06
R8998:Baz2b UTSW 2 59,799,608 (GRCm39) missense probably benign 0.02
R9241:Baz2b UTSW 2 59,743,993 (GRCm39) missense probably benign 0.01
R9245:Baz2b UTSW 2 59,743,331 (GRCm39) missense probably benign
R9577:Baz2b UTSW 2 59,809,031 (GRCm39) missense probably benign 0.06
R9581:Baz2b UTSW 2 59,799,300 (GRCm39) missense probably benign
R9601:Baz2b UTSW 2 59,731,847 (GRCm39) missense possibly damaging 0.66
R9613:Baz2b UTSW 2 59,731,824 (GRCm39) missense probably benign 0.09
R9639:Baz2b UTSW 2 59,731,828 (GRCm39) missense probably benign 0.01
X0011:Baz2b UTSW 2 59,807,705 (GRCm39) missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59,731,019 (GRCm39) missense probably damaging 1.00
X0064:Baz2b UTSW 2 59,799,626 (GRCm39) missense probably benign
Z1088:Baz2b UTSW 2 59,790,359 (GRCm39) missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59,807,864 (GRCm39) missense probably benign 0.01
Z1188:Baz2b UTSW 2 59,807,749 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTCAGCGTTCGAGCATG -3'
(R):5'- ACCAGCCATTACCTCCTGTG -3'

Sequencing Primer
(F):5'- TGGATCGCAATTCACTGG -3'
(R):5'- AGCCATTACCTCCTGTGTCTGAG -3'
Posted On 2014-06-23