Incidental Mutation 'R1826:Exoc3l'
ID 206794
Institutional Source Beutler Lab
Gene Symbol Exoc3l
Ensembl Gene ENSMUSG00000043251
Gene Name exocyst complex component 3-like
Synonyms C730015A04Rik
MMRRC Submission 039853-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.282) question?
Stock # R1826 (G1)
Quality Score 173
Status Validated
Chromosome 8
Chromosomal Location 106016556-106022733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106020250 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 225 (I225N)
Ref Sequence ENSEMBL: ENSMUSP00000053766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014981] [ENSMUST00000015003] [ENSMUST00000057855] [ENSMUST00000171788] [ENSMUST00000212777] [ENSMUST00000212922] [ENSMUST00000212219]
AlphaFold Q8BI71
Predicted Effect probably benign
Transcript: ENSMUST00000014981
SMART Domains Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000015003
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000057855
AA Change: I225N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251
AA Change: I225N

DomainStartEndE-ValueType
Pfam:Sec6 189 722 5.4e-116 PFAM
low complexity region 723 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171788
SMART Domains Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212215
Predicted Effect probably benign
Transcript: ENSMUST00000212777
Predicted Effect probably benign
Transcript: ENSMUST00000212922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212288
Predicted Effect probably benign
Transcript: ENSMUST00000212219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212529
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 95% (116/122)
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,810,453 (GRCm39) S917P probably benign Het
Acsbg1 C T 9: 54,529,840 (GRCm39) V256M possibly damaging Het
Adam34 T A 8: 44,104,379 (GRCm39) D422V probably damaging Het
Adam6a T A 12: 113,509,742 (GRCm39) V705E possibly damaging Het
Adamts12 C A 15: 11,071,606 (GRCm39) P50Q probably benign Het
Arfgap3 C T 15: 83,187,303 (GRCm39) probably null Het
Aspg T A 12: 112,089,852 (GRCm39) D463E probably damaging Het
Atad2b G A 12: 5,024,094 (GRCm39) S73N probably benign Het
Atp11a T C 8: 12,896,154 (GRCm39) L788P probably damaging Het
B3gnt8 T C 7: 25,328,188 (GRCm39) F206S probably damaging Het
Baz2b T C 2: 59,799,077 (GRCm39) E349G probably benign Het
Bmp2k A T 5: 97,209,261 (GRCm39) probably benign Het
Camta2 A G 11: 70,574,134 (GRCm39) F128L probably damaging Het
Ccdc88a A T 11: 29,439,637 (GRCm39) Q30L possibly damaging Het
Cdh1 T C 8: 107,392,898 (GRCm39) M794T probably benign Het
Cdh5 A G 8: 104,857,723 (GRCm39) N383S possibly damaging Het
Cep85l T C 10: 53,224,908 (GRCm39) D227G possibly damaging Het
Clec4e A G 6: 123,260,591 (GRCm39) S156P probably damaging Het
Col10a1 G T 10: 34,270,645 (GRCm39) G206C probably damaging Het
Col4a2 T C 8: 11,363,509 (GRCm39) probably null Het
Copg2 A G 6: 30,789,777 (GRCm39) M517T probably benign Het
Cyp2f2 T A 7: 26,831,987 (GRCm39) L414Q probably damaging Het
Dact1 G A 12: 71,365,118 (GRCm39) G596D probably damaging Het
Dcaf13 T C 15: 38,982,294 (GRCm39) C87R probably damaging Het
Dchs1 T G 7: 105,406,834 (GRCm39) T2224P probably damaging Het
Dnah12 A G 14: 26,432,174 (GRCm39) M429V probably benign Het
Dppa2 G A 16: 48,137,711 (GRCm39) R231H probably damaging Het
Elavl4 T C 4: 110,108,489 (GRCm39) D78G probably damaging Het
Enthd1 T C 15: 80,358,482 (GRCm39) E346G probably damaging Het
Fasn C T 11: 120,699,325 (GRCm39) probably benign Het
Fbxl7 G A 15: 26,552,851 (GRCm39) R139C possibly damaging Het
Fbxw15 C A 9: 109,388,782 (GRCm39) probably null Het
Flnc A G 6: 29,455,184 (GRCm39) T1971A probably damaging Het
Fnip1 T G 11: 54,356,990 (GRCm39) V33G probably damaging Het
Foxn2 A G 17: 88,794,233 (GRCm39) E390G possibly damaging Het
Fry C T 5: 150,360,174 (GRCm39) S1940L possibly damaging Het
Fzd3 A T 14: 65,490,555 (GRCm39) D9E probably benign Het
Gabrd T C 4: 155,470,943 (GRCm39) Y255C probably damaging Het
Garem1 A T 18: 21,262,509 (GRCm39) F768L probably benign Het
Gas2 T A 7: 51,593,421 (GRCm39) L167Q probably damaging Het
Gm16391 A G 17: 76,591,418 (GRCm39) noncoding transcript Het
Gm1979 A T 5: 26,206,240 (GRCm39) N113K probably damaging Het
Gpr83 G T 9: 14,779,629 (GRCm39) C269F possibly damaging Het
Hdac4 T A 1: 91,912,421 (GRCm39) N352Y probably damaging Het
Hdac9 A G 12: 34,479,491 (GRCm39) probably benign Het
Hhipl2 G A 1: 183,217,253 (GRCm39) S673N probably benign Het
Iffo2 T A 4: 139,341,376 (GRCm39) S417T probably benign Het
Itgb5 G T 16: 33,685,930 (GRCm39) R90L possibly damaging Het
Jade1 T G 3: 41,567,648 (GRCm39) L572W probably damaging Het
Kcnh1 T A 1: 192,095,376 (GRCm39) M478K possibly damaging Het
Kcnma1 C A 14: 23,380,997 (GRCm39) D903Y probably damaging Het
Kcnq4 T A 4: 120,561,701 (GRCm39) H456L probably benign Het
Kif9 C A 9: 110,346,701 (GRCm39) T613K probably benign Het
Krt36 T G 11: 99,993,856 (GRCm39) probably benign Het
Kyat3 A T 3: 142,428,940 (GRCm39) D89V possibly damaging Het
Lnpep A T 17: 17,783,098 (GRCm39) F568I probably damaging Het
Lpl T C 8: 69,354,943 (GRCm39) F444L possibly damaging Het
Lrp1 A T 10: 127,389,576 (GRCm39) V3153E probably damaging Het
Lrrn1 A T 6: 107,544,529 (GRCm39) N109I probably benign Het
Ltn1 A G 16: 87,212,504 (GRCm39) Y686H probably damaging Het
Mcoln2 A C 3: 145,881,227 (GRCm39) D166A possibly damaging Het
Ms4a6b A T 19: 11,501,298 (GRCm39) I103F probably damaging Het
Mtmr10 T G 7: 63,987,214 (GRCm39) S585A probably benign Het
Mx1 T C 16: 97,256,837 (GRCm39) N114S possibly damaging Het
Mysm1 A T 4: 94,858,923 (GRCm39) N75K probably benign Het
Nkx1-1 A G 5: 33,591,277 (GRCm39) V15A unknown Het
Nlrp1a G A 11: 71,013,573 (GRCm39) T559I possibly damaging Het
Nlrp1a T A 11: 70,998,806 (GRCm39) probably benign Het
Oas1f A G 5: 120,993,652 (GRCm39) K288R probably benign Het
Or10q1 T A 19: 13,726,711 (GRCm39) D80E probably benign Het
Or55b3 A G 7: 102,126,720 (GRCm39) L119P probably damaging Het
Or9e1 T A 11: 58,732,257 (GRCm39) C106S probably benign Het
Pcdhb2 T A 18: 37,429,038 (GRCm39) V337D probably damaging Het
Pcdhb5 C T 18: 37,454,522 (GRCm39) R301* probably null Het
Phf12 T C 11: 77,915,780 (GRCm39) probably benign Het
Pik3c2a C T 7: 115,967,352 (GRCm39) D862N probably benign Het
Pkhd1l1 T A 15: 44,366,741 (GRCm39) L740I possibly damaging Het
Ppp1r9a A T 6: 5,111,060 (GRCm39) probably benign Het
Prg4 T C 1: 150,327,760 (GRCm39) D820G probably benign Het
Prmt9 C T 8: 78,282,303 (GRCm39) Q67* probably null Het
Prob1 T C 18: 35,786,628 (GRCm39) E542G possibly damaging Het
Pttg1 A G 11: 43,311,193 (GRCm39) V188A probably damaging Het
Rassf1 T A 9: 107,435,392 (GRCm39) L260H probably damaging Het
Rbm5 T A 9: 107,619,613 (GRCm39) Q766L probably damaging Het
Rbms3 T A 9: 116,651,936 (GRCm39) Y137F probably damaging Het
Rccd1 T C 7: 79,969,966 (GRCm39) probably benign Het
Rnf182 G A 13: 43,822,010 (GRCm39) W187* probably null Het
S100a11 A T 3: 93,433,428 (GRCm39) I91F probably benign Het
Setd4 T A 16: 93,388,187 (GRCm39) K100* probably null Het
Simc1 T A 13: 54,672,452 (GRCm39) C267S probably benign Het
Slc16a1 G T 3: 104,558,255 (GRCm39) A91S probably benign Het
Slc36a1 A G 11: 55,111,279 (GRCm39) N133S probably benign Het
Ssxb16 T A X: 8,746,944 (GRCm39) Y133* probably null Het
Svil C T 18: 5,063,383 (GRCm39) P885S probably benign Het
Svop A T 5: 114,198,117 (GRCm39) probably null Het
Taar7d T C 10: 23,903,474 (GRCm39) Y119H probably damaging Het
Tasor2 T A 13: 3,631,759 (GRCm39) N914I probably damaging Het
Tgfb3 T C 12: 86,108,818 (GRCm39) T304A probably benign Het
Tmem94 C A 11: 115,684,039 (GRCm39) C786* probably null Het
Tnfrsf4 T A 4: 156,100,736 (GRCm39) probably null Het
Tns1 C A 1: 73,992,793 (GRCm39) M1I probably null Het
Trappc13 C T 13: 104,306,327 (GRCm39) probably null Het
Trim72 T C 7: 127,607,016 (GRCm39) F182L possibly damaging Het
Ttc6 T C 12: 57,707,033 (GRCm39) S647P probably benign Het
Tulp1 A G 17: 28,575,341 (GRCm39) L400P possibly damaging Het
Vegfc C T 8: 54,634,347 (GRCm39) T342M possibly damaging Het
Vit T A 17: 78,842,105 (GRCm39) V15E probably benign Het
Vps13d A T 4: 144,881,573 (GRCm39) M1334K probably damaging Het
Zfp280d T C 9: 72,206,062 (GRCm39) V23A probably damaging Het
Zfp608 A G 18: 55,031,648 (GRCm39) I764T probably benign Het
Zfp94 T C 7: 24,008,540 (GRCm39) Y33C probably damaging Het
Zfyve26 T A 12: 79,315,823 (GRCm39) I1218F probably damaging Het
Other mutations in Exoc3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Exoc3l APN 8 106,017,130 (GRCm39) missense probably benign 0.25
IGL01731:Exoc3l APN 8 106,019,587 (GRCm39) missense probably benign 0.16
IGL02364:Exoc3l APN 8 106,017,209 (GRCm39) missense possibly damaging 0.71
IGL02413:Exoc3l APN 8 106,019,070 (GRCm39) missense probably damaging 1.00
IGL02512:Exoc3l APN 8 106,017,115 (GRCm39) missense probably damaging 1.00
IGL02810:Exoc3l APN 8 106,021,980 (GRCm39) missense probably damaging 1.00
R0045:Exoc3l UTSW 8 106,020,317 (GRCm39) missense probably damaging 1.00
R0045:Exoc3l UTSW 8 106,020,317 (GRCm39) missense probably damaging 1.00
R0183:Exoc3l UTSW 8 106,021,932 (GRCm39) missense probably damaging 1.00
R0302:Exoc3l UTSW 8 106,020,175 (GRCm39) missense probably benign 0.01
R1660:Exoc3l UTSW 8 106,019,692 (GRCm39) critical splice donor site probably null
R1699:Exoc3l UTSW 8 106,021,645 (GRCm39) missense probably benign 0.34
R2275:Exoc3l UTSW 8 106,017,079 (GRCm39) critical splice donor site probably null
R3928:Exoc3l UTSW 8 106,017,549 (GRCm39) unclassified probably benign
R3938:Exoc3l UTSW 8 106,020,037 (GRCm39) missense probably damaging 1.00
R4261:Exoc3l UTSW 8 106,017,599 (GRCm39) missense probably damaging 0.98
R4273:Exoc3l UTSW 8 106,016,593 (GRCm39) makesense probably null
R5518:Exoc3l UTSW 8 106,019,795 (GRCm39) missense probably benign 0.27
R6471:Exoc3l UTSW 8 106,017,166 (GRCm39) missense probably damaging 1.00
R6511:Exoc3l UTSW 8 106,019,887 (GRCm39) missense probably benign 0.00
R6631:Exoc3l UTSW 8 106,021,993 (GRCm39) missense probably damaging 1.00
R6694:Exoc3l UTSW 8 106,017,122 (GRCm39) missense probably benign 0.15
R6843:Exoc3l UTSW 8 106,016,729 (GRCm39) missense probably benign 0.00
R7310:Exoc3l UTSW 8 106,020,340 (GRCm39) missense probably damaging 1.00
R7387:Exoc3l UTSW 8 106,021,605 (GRCm39) missense probably damaging 1.00
R7442:Exoc3l UTSW 8 106,019,558 (GRCm39) missense probably damaging 1.00
R7764:Exoc3l UTSW 8 106,017,333 (GRCm39) missense possibly damaging 0.62
R7845:Exoc3l UTSW 8 106,016,782 (GRCm39) missense probably damaging 1.00
R8748:Exoc3l UTSW 8 106,016,777 (GRCm39) missense probably damaging 0.98
R8879:Exoc3l UTSW 8 106,017,181 (GRCm39) missense
Z1176:Exoc3l UTSW 8 106,017,426 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AACGTGTCAGCAGCTCCTAG -3'
(R):5'- TATGTGAGCCTGCGGGAACTAG -3'

Sequencing Primer
(F):5'- ACCACACGGTAGCTTGGTG -3'
(R):5'- CCTGCGGGAACTAGAGCAG -3'
Posted On 2014-06-23