Incidental Mutation 'R0114:Myo5b'
ID20684
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
MMRRC Submission 038400-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R0114 (G1)
Quality Score212
Status Validated (trace)
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74742171 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1549 (T1549S)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
Predicted Effect probably benign
Transcript: ENSMUST00000074157
AA Change: T1523S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: T1523S

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121875
AA Change: T1549S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: T1549S

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154986
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,985,982 probably benign Het
4933427D14Rik T C 11: 72,195,799 Y262C probably damaging Het
Adamts1 C A 16: 85,799,614 V379L probably benign Het
Akt3 T C 1: 177,067,251 D260G probably damaging Het
Alms1 T C 6: 85,619,803 L537P probably benign Het
Anln A T 9: 22,353,346 I876N probably damaging Het
Ano9 A T 7: 141,103,239 probably benign Het
Arhgef10l T C 4: 140,583,883 E218G probably benign Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Atp9a G T 2: 168,710,856 Y63* probably null Het
Bmpr2 G T 1: 59,815,340 C116F probably damaging Het
Cand1 T C 10: 119,216,522 D233G probably benign Het
Cftr A T 6: 18,282,448 H1049L probably damaging Het
Ckap5 A T 2: 91,620,112 D1975V possibly damaging Het
Cyp26c1 T C 19: 37,686,633 V134A probably benign Het
Dnaic1 T C 4: 41,605,686 probably benign Het
Dpp10 T C 1: 123,486,092 I163V probably benign Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Fanca A T 8: 123,288,491 probably null Het
Fes A G 7: 80,378,035 V787A probably damaging Het
Fnip1 C T 11: 54,487,801 probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gm1840 A G 8: 5,640,359 noncoding transcript Het
Gmds A T 13: 32,227,281 S57T probably benign Het
Gnpat T G 8: 124,883,357 D426E probably benign Het
Gnptab C A 10: 88,433,400 P655Q possibly damaging Het
Herc1 T A 9: 66,461,846 F2941I probably damaging Het
Herc2 T C 7: 56,153,774 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Itga11 T G 9: 62,735,293 V166G probably damaging Het
Itga11 T C 9: 62,760,302 V639A possibly damaging Het
Itpr2 A G 6: 146,312,879 F1490S probably damaging Het
Lama2 C A 10: 26,993,068 E802* probably null Het
Lgi3 C T 14: 70,531,029 probably benign Het
Limch1 C T 5: 67,036,084 probably benign Het
Lipc T C 9: 70,803,781 N363S probably damaging Het
Lrit2 A G 14: 37,068,045 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mug2 A G 6: 122,040,648 Y448C probably damaging Het
Mybpc3 A G 2: 91,124,494 E450G probably damaging Het
Naa15 T C 3: 51,448,438 probably null Het
Nckap1l T A 15: 103,455,028 C54S probably benign Het
Nlrp9b A G 7: 20,024,056 D406G probably benign Het
Nprl3 T A 11: 32,239,784 probably benign Het
Nvl A G 1: 181,120,391 V429A probably benign Het
Olfr114 A T 17: 37,589,415 *313K probably null Het
Olfr54 G A 11: 51,027,604 V201I probably benign Het
Olfr548-ps1 A T 7: 102,542,731 Q265L probably benign Het
Olfr801 T A 10: 129,669,598 Y307F probably benign Het
Opa1 A T 16: 29,629,635 N912Y probably benign Het
Pcnx T C 12: 81,996,095 V2317A possibly damaging Het
Phf3 A T 1: 30,805,443 N1478K possibly damaging Het
Phykpl G A 11: 51,586,653 D91N probably benign Het
Polr2b T A 5: 77,343,263 C984S probably damaging Het
Ppfibp1 A G 6: 146,998,233 R141G probably benign Het
Ppm1d G A 11: 85,326,905 G20R probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppp2r5b C A 19: 6,228,431 V483F probably benign Het
Ppp4r4 T A 12: 103,576,374 C132S probably benign Het
Prg2 A G 2: 84,983,456 probably benign Het
Prpf4b G A 13: 34,890,488 probably benign Het
Rad54l2 T C 9: 106,713,455 T491A probably damaging Het
Rnf213 G T 11: 119,414,587 W548L probably damaging Het
Rusc2 G T 4: 43,422,055 C825F probably damaging Het
Sema4b A G 7: 80,219,078 probably benign Het
Sema6a A G 18: 47,290,177 V254A probably damaging Het
Slc13a3 A G 2: 165,424,581 F346L probably damaging Het
Slc25a17 T C 15: 81,337,959 D104G probably damaging Het
Specc1 A T 11: 62,146,313 N707Y possibly damaging Het
Tex48 T A 4: 63,608,459 E76V probably damaging Het
Tfr2 T C 5: 137,577,465 V281A probably benign Het
Tgfb1i1 A C 7: 128,249,494 Q238H probably damaging Het
Thoc6 G A 17: 23,670,239 T122I probably benign Het
Tmtc1 G A 6: 148,412,830 probably benign Het
Tnfrsf8 T C 4: 145,288,047 D264G possibly damaging Het
Trim43a T A 9: 88,584,160 I178N probably damaging Het
Ttn G C 2: 76,707,093 I26503M possibly damaging Het
Usp28 C A 9: 49,039,023 D589E probably benign Het
Utp23 T C 15: 51,882,511 S242P probably damaging Het
Vwa3a A G 7: 120,775,380 Y305C probably benign Het
Vwa5b1 C A 4: 138,608,858 E142* probably null Het
Xrn2 A T 2: 147,029,779 T374S probably damaging Het
Zfp735 A T 11: 73,710,662 Q144L probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
unrat UTSW 18 74653361 missense possibly damaging 0.93
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 synonymous probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74627254 critical splice donor site probably null
R7635:Myo5b UTSW 18 74580396 missense probably damaging 1.00
R7670:Myo5b UTSW 18 74701446 missense probably benign 0.05
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACTCATCAGGAGACTGAGGAGTGAC -3'
(R):5'- AGAAAGGCATTCCCACAATCTGAGG -3'

Sequencing Primer
(F):5'- GCTCAGCAAAGATTAGCTCTG -3'
(R):5'- ACAATCTGAGGTTCCAGCAG -3'
Posted On2013-04-11