Incidental Mutation 'R0114:Myo5b'
ID 20684
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 038400-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.734) question?
Stock # R0114 (G1)
Quality Score 212
Status Validated (trace)
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74875242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1549 (T1549S)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000074157
AA Change: T1523S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: T1523S

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121875
AA Change: T1549S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: T1549S

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154986
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,861,978 (GRCm39) probably benign Het
4933427D14Rik T C 11: 72,086,625 (GRCm39) Y262C probably damaging Het
Adamts1 C A 16: 85,596,502 (GRCm39) V379L probably benign Het
Akt3 T C 1: 176,894,817 (GRCm39) D260G probably damaging Het
Alms1 T C 6: 85,596,785 (GRCm39) L537P probably benign Het
Anln A T 9: 22,264,642 (GRCm39) I876N probably damaging Het
Ano9 A T 7: 140,683,152 (GRCm39) probably benign Het
Arhgef10l T C 4: 140,311,194 (GRCm39) E218G probably benign Het
Arnt2 G A 7: 83,996,738 (GRCm39) R63C probably damaging Het
Atp9a G T 2: 168,552,776 (GRCm39) Y63* probably null Het
Bmpr2 G T 1: 59,854,499 (GRCm39) C116F probably damaging Het
Cand1 T C 10: 119,052,427 (GRCm39) D233G probably benign Het
Cftr A T 6: 18,282,447 (GRCm39) H1049L probably damaging Het
Ckap5 A T 2: 91,450,457 (GRCm39) D1975V possibly damaging Het
Cyp26c1 T C 19: 37,675,081 (GRCm39) V134A probably benign Het
Dnai1 T C 4: 41,605,686 (GRCm39) probably benign Het
Dpp10 T C 1: 123,413,821 (GRCm39) I163V probably benign Het
Fam151a A T 4: 106,591,201 (GRCm39) I15F possibly damaging Het
Fanca A T 8: 124,015,230 (GRCm39) probably null Het
Fes A G 7: 80,027,783 (GRCm39) V787A probably damaging Het
Fnip1 C T 11: 54,378,627 (GRCm39) probably benign Het
Gabpb1 A G 2: 126,495,494 (GRCm39) I86T probably damaging Het
Gmds A T 13: 32,411,264 (GRCm39) S57T probably benign Het
Gnpat T G 8: 125,610,096 (GRCm39) D426E probably benign Het
Gnptab C A 10: 88,269,262 (GRCm39) P655Q possibly damaging Het
Gpi-ps A G 8: 5,690,359 (GRCm39) noncoding transcript Het
Herc1 T A 9: 66,369,128 (GRCm39) F2941I probably damaging Het
Herc2 T C 7: 55,803,522 (GRCm39) probably benign Het
Ino80 G A 2: 119,213,441 (GRCm39) R1249C probably damaging Het
Itga11 T G 9: 62,642,575 (GRCm39) V166G probably damaging Het
Itga11 T C 9: 62,667,584 (GRCm39) V639A possibly damaging Het
Itpr2 A G 6: 146,214,377 (GRCm39) F1490S probably damaging Het
Lama2 C A 10: 26,869,064 (GRCm39) E802* probably null Het
Lgi3 C T 14: 70,768,469 (GRCm39) probably benign Het
Limch1 C T 5: 67,193,427 (GRCm39) probably benign Het
Lipc T C 9: 70,711,063 (GRCm39) N363S probably damaging Het
Lrit2 A G 14: 36,790,002 (GRCm39) probably null Het
Mfsd13a C T 19: 46,354,943 (GRCm39) T40I probably benign Het
Mug2 A G 6: 122,017,607 (GRCm39) Y448C probably damaging Het
Mybpc3 A G 2: 90,954,839 (GRCm39) E450G probably damaging Het
Naa15 T C 3: 51,355,859 (GRCm39) probably null Het
Nckap1l T A 15: 103,363,455 (GRCm39) C54S probably benign Het
Nlrp9b A G 7: 19,757,981 (GRCm39) D406G probably benign Het
Nprl3 T A 11: 32,189,784 (GRCm39) probably benign Het
Nvl A G 1: 180,947,956 (GRCm39) V429A probably benign Het
Opa1 A T 16: 29,448,453 (GRCm39) N912Y probably benign Het
Or14j3 A T 17: 37,900,306 (GRCm39) *313K probably null Het
Or1x2 G A 11: 50,918,431 (GRCm39) V201I probably benign Het
Or52b4i A T 7: 102,191,938 (GRCm39) Q265L probably benign Het
Or6c211 T A 10: 129,505,467 (GRCm39) Y307F probably benign Het
Pcnx1 T C 12: 82,042,869 (GRCm39) V2317A possibly damaging Het
Phf3 A T 1: 30,844,524 (GRCm39) N1478K possibly damaging Het
Phykpl G A 11: 51,477,480 (GRCm39) D91N probably benign Het
Polr2b T A 5: 77,491,110 (GRCm39) C984S probably damaging Het
Ppfibp1 A G 6: 146,899,731 (GRCm39) R141G probably benign Het
Ppm1d G A 11: 85,217,731 (GRCm39) G20R probably damaging Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Ppp2r5b C A 19: 6,278,461 (GRCm39) V483F probably benign Het
Ppp4r4 T A 12: 103,542,633 (GRCm39) C132S probably benign Het
Prg2 A G 2: 84,813,800 (GRCm39) probably benign Het
Prpf4b G A 13: 35,074,471 (GRCm39) probably benign Het
Rad54l2 T C 9: 106,590,654 (GRCm39) T491A probably damaging Het
Rnf213 G T 11: 119,305,413 (GRCm39) W548L probably damaging Het
Rusc2 G T 4: 43,422,055 (GRCm39) C825F probably damaging Het
Sema4b A G 7: 79,868,826 (GRCm39) probably benign Het
Sema6a A G 18: 47,423,244 (GRCm39) V254A probably damaging Het
Slc13a3 A G 2: 165,266,501 (GRCm39) F346L probably damaging Het
Slc25a17 T C 15: 81,222,160 (GRCm39) D104G probably damaging Het
Specc1 A T 11: 62,037,139 (GRCm39) N707Y possibly damaging Het
Tex48 T A 4: 63,526,696 (GRCm39) E76V probably damaging Het
Tfr2 T C 5: 137,575,727 (GRCm39) V281A probably benign Het
Tgfb1i1 A C 7: 127,848,666 (GRCm39) Q238H probably damaging Het
Thoc6 G A 17: 23,889,213 (GRCm39) T122I probably benign Het
Tmtc1 G A 6: 148,314,328 (GRCm39) probably benign Het
Tnfrsf8 T C 4: 145,014,617 (GRCm39) D264G possibly damaging Het
Trim43a T A 9: 88,466,213 (GRCm39) I178N probably damaging Het
Ttn G C 2: 76,537,437 (GRCm39) I26503M possibly damaging Het
Usp28 C A 9: 48,950,323 (GRCm39) D589E probably benign Het
Utp23 T C 15: 51,745,907 (GRCm39) S242P probably damaging Het
Vwa3a A G 7: 120,374,603 (GRCm39) Y305C probably benign Het
Vwa5b1 C A 4: 138,336,169 (GRCm39) E142* probably null Het
Xrn2 A T 2: 146,871,699 (GRCm39) T374S probably damaging Het
Zfp735 A T 11: 73,601,488 (GRCm39) Q144L probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0494:Myo5b UTSW 18 74,787,038 (GRCm39) missense probably damaging 1.00
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R2888:Myo5b UTSW 18 74,895,689 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74,828,455 (GRCm39) missense probably benign 0.19
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5187:Myo5b UTSW 18 74,834,745 (GRCm39) missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5254:Myo5b UTSW 18 74,833,677 (GRCm39) missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6331:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74,834,599 (GRCm39) missense probably benign 0.01
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8383:Myo5b UTSW 18 74,777,049 (GRCm39) missense probably benign 0.05
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACTCATCAGGAGACTGAGGAGTGAC -3'
(R):5'- AGAAAGGCATTCCCACAATCTGAGG -3'

Sequencing Primer
(F):5'- GCTCAGCAAAGATTAGCTCTG -3'
(R):5'- ACAATCTGAGGTTCCAGCAG -3'
Posted On 2013-04-11