Mutagenetix > Incidental Mutation

Incidental Mutation 'R1826:Pkhd1l1'

206841

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1l1

Ensembl Gene

ENSMUSG00000038725

Gene Name

polycystic kidney and hepatic disease 1-like 1

Synonyms

PKHDL1, D86 mRNA, fibrocystin L

MMRRC Submission

039853-MU

Accession Numbers

Genbank: NM_138674; MGI: 2183153

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1826 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44457494-44601369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 44503345 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 740 (L740I)

Ref Sequence

ENSEMBL: ENSMUSP00000036988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038336
AA Change: L740I

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: L740I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IPT	30	141	9.02e-3	SMART
Pfam:TIG	146	255	1.6e-16	PFAM
IPT	269	362	2.27e-8	SMART
PbH1	398	420	2.98e3	SMART
IPT	1066	1154	5.34e-5	SMART
IPT	1156	1235	1.44e-1	SMART
Pfam:TIG	1240	1322	1.1e-13	PFAM
IPT	1328	1407	7.06e0	SMART
Pfam:TIG	1565	1645	5.1e-11	PFAM
IPT	1657	1743	1.89e-5	SMART
Pfam:TIG	1748	1828	2.1e-10	PFAM
IPT	1829	1910	4.87e-8	SMART
IPT	1914	1997	6.84e-3	SMART
IPT	1998	2085	9.86e-1	SMART
IPT	2089	2176	7.21e-11	SMART
PbH1	2105	2126	1.56e3	SMART
G8	2183	2303	2.37e-59	SMART
PbH1	2484	2506	9.48e3	SMART
PbH1	2507	2529	8.45e2	SMART
PbH1	2565	2587	4.11e3	SMART
PbH1	2664	2686	3.5e3	SMART
PbH1	2732	2755	2.7e3	SMART
Blast:G8	2949	2979	1e-5	BLAST
low complexity region	3014	3025	N/A	INTRINSIC
G8	3035	3173	6.5e-57	SMART
PbH1	3292	3314	1.96e3	SMART
PbH1	3354	3376	3.79e1	SMART
PbH1	3415	3437	4.87e2	SMART
PbH1	3470	3492	8.34e3	SMART
PbH1	3493	3514	5.86e3	SMART
low complexity region	3563	3574	N/A	INTRINSIC
low complexity region	4076	4103	N/A	INTRINSIC
low complexity region	4184	4212	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166957
AA Change: L740I

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: L740I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IPT	30	141	9.02e-3	SMART
Pfam:TIG	146	255	9.4e-18	PFAM
IPT	269	362	2.27e-8	SMART
PbH1	398	420	2.98e3	SMART
IPT	1066	1154	5.34e-5	SMART
IPT	1156	1235	1.44e-1	SMART
Pfam:TIG	1240	1323	3e-13	PFAM
IPT	1328	1407	7.06e0	SMART
Pfam:TIG	1565	1645	3.7e-11	PFAM
IPT	1657	1743	1.89e-5	SMART
Pfam:TIG	1748	1828	9.7e-12	PFAM
IPT	1829	1910	4.87e-8	SMART
IPT	1914	1997	6.84e-3	SMART
IPT	1998	2085	9.86e-1	SMART
IPT	2089	2176	7.21e-11	SMART
PbH1	2105	2126	1.56e3	SMART
G8	2183	2303	2.37e-59	SMART
PbH1	2484	2506	9.48e3	SMART
PbH1	2507	2529	8.45e2	SMART
PbH1	2565	2587	4.11e3	SMART
PbH1	2664	2686	3.5e3	SMART
PbH1	2732	2755	2.7e3	SMART
Blast:G8	2949	2979	1e-5	BLAST
low complexity region	3014	3025	N/A	INTRINSIC
G8	3035	3173	6.5e-57	SMART
PbH1	3292	3314	1.96e3	SMART
PbH1	3354	3376	3.79e1	SMART
PbH1	3415	3437	4.87e2	SMART
PbH1	3470	3492	8.34e3	SMART
PbH1	3493	3514	5.86e3	SMART
low complexity region	3563	3574	N/A	INTRINSIC
low complexity region	4076	4103	N/A	INTRINSIC
low complexity region	4184	4212	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209244
AA Change: L740I

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

95% (116/122)

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	T	C	19: 43,822,014	S917P	probably benign	Het
Acsbg1	C	T	9: 54,622,556	V256M	possibly damaging	Het
Adam34	T	A	8: 43,651,342	D422V	probably damaging	Het
Adam6a	T	A	12: 113,546,122	V705E	possibly damaging	Het
Adamts12	C	A	15: 11,071,520	P50Q	probably benign	Het
Arfgap3	C	T	15: 83,303,102		probably null	Het
Aspg	T	A	12: 112,123,418	D463E	probably damaging	Het
Atad2b	G	A	12: 4,974,094	S73N	probably benign	Het
Atp11a	T	C	8: 12,846,154	L788P	probably damaging	Het
B3gnt8	T	C	7: 25,628,763	F206S	probably damaging	Het
Baz2b	T	C	2: 59,968,733	E349G	probably benign	Het
Bmp2k	A	T	5: 97,061,402		probably benign	Het
Camta2	A	G	11: 70,683,308	F128L	probably damaging	Het
Ccdc88a	A	T	11: 29,489,637	Q30L	possibly damaging	Het
Cdh1	T	C	8: 106,666,266	M794T	probably benign	Het
Cdh5	A	G	8: 104,131,091	N383S	possibly damaging	Het
Cep85l	T	C	10: 53,348,812	D227G	possibly damaging	Het
Clec4e	A	G	6: 123,283,632	S156P	probably damaging	Het
Col10a1	G	T	10: 34,394,649	G206C	probably damaging	Het
Col4a2	T	C	8: 11,313,509		probably null	Het
Copg2	A	G	6: 30,812,842	M517T	probably benign	Het
Cyp2f2	T	A	7: 27,132,562	L414Q	probably damaging	Het
Dact1	G	A	12: 71,318,344	G596D	probably damaging	Het
Dcaf13	T	C	15: 39,118,899	C87R	probably damaging	Het
Dchs1	T	G	7: 105,757,627	T2224P	probably damaging	Het
Dnah12	A	G	14: 26,711,019	M429V	probably benign	Het
Dppa2	G	A	16: 48,317,348	R231H	probably damaging	Het
Elavl4	T	C	4: 110,251,292	D78G	probably damaging	Het
Enthd1	T	C	15: 80,474,281	E346G	probably damaging	Het
Exoc3l	A	T	8: 105,293,618	I225N	probably damaging	Het
Fam208b	T	A	13: 3,581,759	N914I	probably damaging	Het
Fasn	C	T	11: 120,808,499		probably benign	Het
Fbxl7	G	A	15: 26,552,765	R139C	possibly damaging	Het
Fbxw15	C	A	9: 109,559,714		probably null	Het
Flnc	A	G	6: 29,455,185	T1971A	probably damaging	Het
Fnip1	T	G	11: 54,466,164	V33G	probably damaging	Het
Foxn2	A	G	17: 88,486,805	E390G	possibly damaging	Het
Fry	C	T	5: 150,436,709	S1940L	possibly damaging	Het
Fzd3	A	T	14: 65,253,106	D9E	probably benign	Het
Gabrd	T	C	4: 155,386,486	Y255C	probably damaging	Het
Garem1	A	T	18: 21,129,452	F768L	probably benign	Het
Gas2	T	A	7: 51,943,673	L167Q	probably damaging	Het
Gm16391	A	G	17: 76,284,423		noncoding transcript	Het
Gm1979	A	T	5: 26,001,242	N113K	probably damaging	Het
Gm5751	T	A	X: 8,880,705	Y133*	probably null	Het
Gpr83	G	T	9: 14,868,333	C269F	possibly damaging	Het
Hdac4	T	A	1: 91,984,699	N352Y	probably damaging	Het
Hdac9	A	G	12: 34,429,492		probably benign	Het
Hhipl2	G	A	1: 183,436,344	S673N	probably benign	Het
Iffo2	T	A	4: 139,614,065	S417T	probably benign	Het
Itgb5	G	T	16: 33,865,560	R90L	possibly damaging	Het
Jade1	T	G	3: 41,613,213	L572W	probably damaging	Het
Kcnh1	T	A	1: 192,413,068	M478K	possibly damaging	Het
Kcnma1	C	A	14: 23,330,929	D903Y	probably damaging	Het
Kcnq4	T	A	4: 120,704,504	H456L	probably benign	Het
Kif9	C	A	9: 110,517,633	T613K	probably benign	Het
Krt36	T	G	11: 100,103,030		probably benign	Het
Kyat3	A	T	3: 142,723,179	D89V	possibly damaging	Het
Lnpep	A	T	17: 17,562,836	F568I	probably damaging	Het
Lpl	T	C	8: 68,902,291	F444L	possibly damaging	Het
Lrp1	A	T	10: 127,553,707	V3153E	probably damaging	Het
Lrrn1	A	T	6: 107,567,568	N109I	probably benign	Het
Ltn1	A	G	16: 87,415,616	Y686H	probably damaging	Het
Mcoln2	A	C	3: 146,175,472	D166A	possibly damaging	Het
Ms4a6b	A	T	19: 11,523,934	I103F	probably damaging	Het
Mtmr10	T	G	7: 64,337,466	S585A	probably benign	Het
Mx1	T	C	16: 97,455,637	N114S	possibly damaging	Het
Mysm1	A	T	4: 94,970,686	N75K	probably benign	Het
Nkx1-1	A	G	5: 33,433,933	V15A	unknown	Het
Nlrp1a	T	A	11: 71,107,980		probably benign	Het
Nlrp1a	G	A	11: 71,122,747	T559I	possibly damaging	Het
Oas1f	A	G	5: 120,855,589	K288R	probably benign	Het
Olfr1494	T	A	19: 13,749,347	D80E	probably benign	Het
Olfr311	T	A	11: 58,841,431	C106S	probably benign	Het
Olfr543	A	G	7: 102,477,513	L119P	probably damaging	Het
Pcdhb2	T	A	18: 37,295,985	V337D	probably damaging	Het
Pcdhb5	C	T	18: 37,321,469	R301*	probably null	Het
Phf12	T	C	11: 78,024,954		probably benign	Het
Pik3c2a	C	T	7: 116,368,117	D862N	probably benign	Het
Ppp1r9a	A	T	6: 5,111,060		probably benign	Het
Prg4	T	C	1: 150,452,009	D820G	probably benign	Het
Prmt9	C	T	8: 77,555,674	Q67*	probably null	Het
Prob1	T	C	18: 35,653,575	E542G	possibly damaging	Het
Pttg1	A	G	11: 43,420,366	V188A	probably damaging	Het
Rassf1	T	A	9: 107,558,193	L260H	probably damaging	Het
Rbm5	T	A	9: 107,742,414	Q766L	probably damaging	Het
Rbms3	T	A	9: 116,822,868	Y137F	probably damaging	Het
Rccd1	T	C	7: 80,320,218		probably benign	Het
Rnf182	G	A	13: 43,668,534	W187*	probably null	Het
S100a11	A	T	3: 93,526,121	I91F	probably benign	Het
Setd4	T	A	16: 93,591,299	K100*	probably null	Het
Simc1	T	A	13: 54,524,639	C267S	probably benign	Het
Slc16a1	G	T	3: 104,650,939	A91S	probably benign	Het
Slc36a1	A	G	11: 55,220,453	N133S	probably benign	Het
Svil	C	T	18: 5,063,383	P885S	probably benign	Het
Svop	A	T	5: 114,060,056		probably null	Het
Taar7d	T	C	10: 24,027,576	Y119H	probably damaging	Het
Tgfb3	T	C	12: 86,062,044	T304A	probably benign	Het
Tmem94	C	A	11: 115,793,213	C786*	probably null	Het
Tnfrsf4	T	A	4: 156,016,279		probably null	Het
Tns1	C	A	1: 73,953,634	M1I	probably null	Het
Trappc13	C	T	13: 104,169,819		probably null	Het
Trim72	T	C	7: 128,007,844	F182L	possibly damaging	Het
Ttc6	T	C	12: 57,660,247	S647P	probably benign	Het
Tulp1	A	G	17: 28,356,367	L400P	possibly damaging	Het
Vegfc	C	T	8: 54,181,312	T342M	possibly damaging	Het
Vit	T	A	17: 78,534,676	V15E	probably benign	Het
Vps13d	A	T	4: 145,155,003	M1334K	probably damaging	Het
Zfp280d	T	C	9: 72,298,780	V23A	probably damaging	Het
Zfp608	A	G	18: 54,898,576	I764T	probably benign	Het
Zfp94	T	C	7: 24,309,115	Y33C	probably damaging	Het
Zfyve26	T	A	12: 79,269,049	I1218F	probably damaging	Het

Other mutations in Pkhd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Pkhd1l1	APN	15	44477586	missense	probably damaging	1.00
IGL00235:Pkhd1l1	APN	15	44556019	missense	probably damaging	1.00
IGL00264:Pkhd1l1	APN	15	44491029	missense	possibly damaging	0.67
IGL00537:Pkhd1l1	APN	15	44591992	missense	possibly damaging	0.88
IGL00537:Pkhd1l1	APN	15	44500047	missense	probably benign	0.42
IGL00580:Pkhd1l1	APN	15	44586474	missense	probably damaging	0.98
IGL01085:Pkhd1l1	APN	15	44562752	splice site	probably null
IGL01089:Pkhd1l1	APN	15	44483869	splice site	probably benign
IGL01094:Pkhd1l1	APN	15	44546929	missense	probably benign	0.09
IGL01120:Pkhd1l1	APN	15	44505312	critical splice donor site	probably null
IGL01307:Pkhd1l1	APN	15	44530029	missense	possibly damaging	0.82
IGL01362:Pkhd1l1	APN	15	44532982	missense	probably benign	0.00
IGL01403:Pkhd1l1	APN	15	44483833	nonsense	probably null
IGL01546:Pkhd1l1	APN	15	44566316	missense	probably damaging	1.00
IGL01596:Pkhd1l1	APN	15	44529410	missense	possibly damaging	0.50
IGL01696:Pkhd1l1	APN	15	44529351	missense	possibly damaging	0.79
IGL01844:Pkhd1l1	APN	15	44499400	splice site	probably benign
IGL02007:Pkhd1l1	APN	15	44533733	splice site	probably benign
IGL02041:Pkhd1l1	APN	15	44493056	splice site	probably null
IGL02171:Pkhd1l1	APN	15	44516146	missense	possibly damaging	0.80
IGL02206:Pkhd1l1	APN	15	44512849	missense	probably benign	0.08
IGL02266:Pkhd1l1	APN	15	44573614	missense	probably damaging	1.00
IGL02487:Pkhd1l1	APN	15	44459426	missense	possibly damaging	0.65
IGL02488:Pkhd1l1	APN	15	44558597	missense	probably benign
IGL02522:Pkhd1l1	APN	15	44555902	missense	possibly damaging	0.71
IGL02554:Pkhd1l1	APN	15	44578500	missense	probably damaging	1.00
IGL02566:Pkhd1l1	APN	15	44526054	splice site	probably null
IGL02602:Pkhd1l1	APN	15	44557931	missense	probably damaging	1.00
IGL02606:Pkhd1l1	APN	15	44589456	missense	probably benign	0.00
IGL02623:Pkhd1l1	APN	15	44584873	missense	probably damaging	1.00
IGL02634:Pkhd1l1	APN	15	44539667	missense	probably damaging	1.00
IGL02637:Pkhd1l1	APN	15	44564324	missense	probably damaging	1.00
IGL02651:Pkhd1l1	APN	15	44483814	missense	probably damaging	1.00
IGL02679:Pkhd1l1	APN	15	44530045	critical splice donor site	probably null
IGL02684:Pkhd1l1	APN	15	44516209	critical splice donor site	probably null
IGL02739:Pkhd1l1	APN	15	44540950	missense	probably benign	0.11
IGL02831:Pkhd1l1	APN	15	44501493	missense	probably benign	0.18
IGL02839:Pkhd1l1	APN	15	44529543	missense	probably damaging	0.98
IGL02944:Pkhd1l1	APN	15	44501531	missense	probably damaging	1.00
IGL02957:Pkhd1l1	APN	15	44512908	missense	probably damaging	1.00
IGL03001:Pkhd1l1	APN	15	44558004	missense	probably damaging	1.00
IGL03030:Pkhd1l1	APN	15	44591976	missense	probably benign	0.00
IGL03030:Pkhd1l1	APN	15	44596902	missense	probably benign	0.41
IGL03132:Pkhd1l1	APN	15	44574617	missense	probably damaging	1.00
IGL03194:Pkhd1l1	APN	15	44518135	missense	probably damaging	1.00
IGL03219:Pkhd1l1	APN	15	44596895	missense	possibly damaging	0.62
IGL03236:Pkhd1l1	APN	15	44581826	missense	probably damaging	1.00
IGL03266:Pkhd1l1	APN	15	44538952	missense	probably damaging	1.00
IGL03276:Pkhd1l1	APN	15	44594584	missense	possibly damaging	0.77
IGL03284:Pkhd1l1	APN	15	44547518	splice site	probably benign
IGL03377:Pkhd1l1	APN	15	44484351	splice site	probably null
R0310_Pkhd1l1_251	UTSW	15	44522738	splice site	probably benign
R0344_Pkhd1l1_462	UTSW	15	44597011	missense	probably benign	0.15
R1737_Pkhd1l1_815	UTSW	15	44547509	critical splice donor site	probably null
R5049_Pkhd1l1_556	UTSW	15	44457616	missense	probably benign	0.00
K7371:Pkhd1l1	UTSW	15	44537442	missense	possibly damaging	0.67
K7371:Pkhd1l1	UTSW	15	44500067	missense	possibly damaging	0.94
N/A - 287:Pkhd1l1	UTSW	15	44582258	missense	probably damaging	0.98
P4717OSA:Pkhd1l1	UTSW	15	44523499	missense	probably benign	0.17
P4717OSA:Pkhd1l1	UTSW	15	44528247	missense	probably damaging	1.00
R0007:Pkhd1l1	UTSW	15	44574398	splice site	probably benign
R0020:Pkhd1l1	UTSW	15	44556872	missense	probably damaging	1.00
R0034:Pkhd1l1	UTSW	15	44504009	missense	probably benign	0.00
R0040:Pkhd1l1	UTSW	15	44573625	missense	probably damaging	1.00
R0050:Pkhd1l1	UTSW	15	44573807	missense	possibly damaging	0.79
R0050:Pkhd1l1	UTSW	15	44573807	missense	possibly damaging	0.79
R0063:Pkhd1l1	UTSW	15	44529237	missense	probably damaging	1.00
R0063:Pkhd1l1	UTSW	15	44529237	missense	probably damaging	1.00
R0086:Pkhd1l1	UTSW	15	44556008	missense	possibly damaging	0.94
R0103:Pkhd1l1	UTSW	15	44597141	missense	probably benign
R0103:Pkhd1l1	UTSW	15	44597141	missense	probably benign
R0127:Pkhd1l1	UTSW	15	44554605	missense	probably damaging	0.99
R0226:Pkhd1l1	UTSW	15	44526784	missense	possibly damaging	0.65
R0268:Pkhd1l1	UTSW	15	44597011	missense	probably benign	0.15
R0294:Pkhd1l1	UTSW	15	44560435	missense	probably benign	0.05
R0310:Pkhd1l1	UTSW	15	44522738	splice site	probably benign
R0344:Pkhd1l1	UTSW	15	44597011	missense	probably benign	0.15
R0449:Pkhd1l1	UTSW	15	44501519	missense	probably damaging	1.00
R0492:Pkhd1l1	UTSW	15	44519690	missense	probably benign	0.03
R0505:Pkhd1l1	UTSW	15	44589418	missense	probably damaging	1.00
R0529:Pkhd1l1	UTSW	15	44526754	missense	possibly damaging	0.62
R0543:Pkhd1l1	UTSW	15	44523491	critical splice acceptor site	probably null
R0552:Pkhd1l1	UTSW	15	44489546	missense	probably damaging	0.98
R0558:Pkhd1l1	UTSW	15	44484424	missense	probably damaging	0.97
R0609:Pkhd1l1	UTSW	15	44467424	missense	possibly damaging	0.48
R0619:Pkhd1l1	UTSW	15	44483838	missense	probably damaging	1.00
R0727:Pkhd1l1	UTSW	15	44535788	missense	possibly damaging	0.80
R0787:Pkhd1l1	UTSW	15	44529264	missense	probably damaging	1.00
R0846:Pkhd1l1	UTSW	15	44495597	missense	probably damaging	1.00
R0909:Pkhd1l1	UTSW	15	44538883	splice site	probably null
R0942:Pkhd1l1	UTSW	15	44532959	missense	probably benign	0.01
R1056:Pkhd1l1	UTSW	15	44591964	missense	probably damaging	1.00
R1147:Pkhd1l1	UTSW	15	44537441	missense	probably null	0.15
R1147:Pkhd1l1	UTSW	15	44537441	missense	probably null	0.15
R1187:Pkhd1l1	UTSW	15	44498051	missense	possibly damaging	0.65
R1328:Pkhd1l1	UTSW	15	44497996	missense	probably benign	0.01
R1331:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1331:Pkhd1l1	UTSW	15	44589597	missense	probably damaging	1.00
R1332:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1335:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1338:Pkhd1l1	UTSW	15	44526724	missense	probably damaging	1.00
R1440:Pkhd1l1	UTSW	15	44540988	splice site	probably benign
R1445:Pkhd1l1	UTSW	15	44505644	missense	probably benign	0.32
R1458:Pkhd1l1	UTSW	15	44516115	missense	probably benign	0.01
R1469:Pkhd1l1	UTSW	15	44536886	missense	probably benign	0.45
R1469:Pkhd1l1	UTSW	15	44536886	missense	probably benign	0.45
R1500:Pkhd1l1	UTSW	15	44545494	missense	probably damaging	1.00
R1528:Pkhd1l1	UTSW	15	44526724	missense	probably damaging	1.00
R1542:Pkhd1l1	UTSW	15	44528191	missense	probably benign	0.44
R1568:Pkhd1l1	UTSW	15	44545501	splice site	probably null
R1571:Pkhd1l1	UTSW	15	44526841	missense	probably benign
R1572:Pkhd1l1	UTSW	15	44543473	missense	probably benign	0.01
R1604:Pkhd1l1	UTSW	15	44467367	nonsense	probably null
R1638:Pkhd1l1	UTSW	15	44597117	missense	probably benign	0.06
R1639:Pkhd1l1	UTSW	15	44540955	missense	probably damaging	0.99
R1737:Pkhd1l1	UTSW	15	44547509	critical splice donor site	probably null
R1816:Pkhd1l1	UTSW	15	44528239	missense	possibly damaging	0.91
R1880:Pkhd1l1	UTSW	15	44525242	missense	probably benign	0.13
R1930:Pkhd1l1	UTSW	15	44503337	missense	possibly damaging	0.69
R1933:Pkhd1l1	UTSW	15	44540884	missense	possibly damaging	0.48
R1938:Pkhd1l1	UTSW	15	44500038	missense	probably benign
R1975:Pkhd1l1	UTSW	15	44529713	missense	probably damaging	1.00
R1999:Pkhd1l1	UTSW	15	44499982	splice site	probably null
R2037:Pkhd1l1	UTSW	15	44568221	splice site	probably null
R2045:Pkhd1l1	UTSW	15	44479654	missense	probably damaging	1.00
R2049:Pkhd1l1	UTSW	15	44547513	splice site	probably benign
R2049:Pkhd1l1	UTSW	15	44581741	missense	probably damaging	1.00
R2063:Pkhd1l1	UTSW	15	44550752	missense	possibly damaging	0.69
R2072:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2073:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2075:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2078:Pkhd1l1	UTSW	15	44527767	missense	probably benign	0.08
R2116:Pkhd1l1	UTSW	15	44569482	missense	probably damaging	0.97
R2133:Pkhd1l1	UTSW	15	44516185	missense	possibly damaging	0.91
R2138:Pkhd1l1	UTSW	15	44501457	missense	probably damaging	1.00
R2139:Pkhd1l1	UTSW	15	44529818	missense	possibly damaging	0.46
R2145:Pkhd1l1	UTSW	15	44512877	splice site	probably null
R2150:Pkhd1l1	UTSW	15	44499982	splice site	probably null
R2177:Pkhd1l1	UTSW	15	44459395	missense	probably benign
R2184:Pkhd1l1	UTSW	15	44499296	missense	possibly damaging	0.89
R2216:Pkhd1l1	UTSW	15	44573895	missense	probably damaging	1.00
R2226:Pkhd1l1	UTSW	15	44512792	missense	possibly damaging	0.79
R2227:Pkhd1l1	UTSW	15	44512792	missense	possibly damaging	0.79
R2243:Pkhd1l1	UTSW	15	44546927	missense	probably damaging	1.00
R2290:Pkhd1l1	UTSW	15	44528250	missense	probably benign	0.03
R2294:Pkhd1l1	UTSW	15	44479607	missense	probably damaging	0.99
R2346:Pkhd1l1	UTSW	15	44560506	missense	possibly damaging	0.82
R2356:Pkhd1l1	UTSW	15	44533019	missense	probably benign	0.00
R2386:Pkhd1l1	UTSW	15	44528178	missense	probably benign	0.00
R2404:Pkhd1l1	UTSW	15	44550820	missense	probably damaging	1.00
R2504:Pkhd1l1	UTSW	15	44485428	missense	probably damaging	0.97
R2679:Pkhd1l1	UTSW	15	44545386	missense	probably damaging	0.99
R2860:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2861:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2862:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2972:Pkhd1l1	UTSW	15	44547248	missense	possibly damaging	0.65
R3016:Pkhd1l1	UTSW	15	44545370	missense	probably benign	0.02
R3162:Pkhd1l1	UTSW	15	44505528	missense	probably damaging	1.00
R3162:Pkhd1l1	UTSW	15	44505528	missense	probably damaging	1.00
R3416:Pkhd1l1	UTSW	15	44547364	missense	probably damaging	1.00
R3623:Pkhd1l1	UTSW	15	44526869	missense	probably damaging	1.00
R3687:Pkhd1l1	UTSW	15	44546587	missense	probably benign	0.17
R3755:Pkhd1l1	UTSW	15	44589406	missense	probably damaging	1.00
R3776:Pkhd1l1	UTSW	15	44514975	critical splice donor site	probably null
R3803:Pkhd1l1	UTSW	15	44493135	missense	probably benign	0.25
R3942:Pkhd1l1	UTSW	15	44592026	critical splice donor site	probably null
R4010:Pkhd1l1	UTSW	15	44529100	missense	possibly damaging	0.80
R4049:Pkhd1l1	UTSW	15	44498557	missense	probably damaging	1.00
R4059:Pkhd1l1	UTSW	15	44550760	missense	probably benign	0.01
R4179:Pkhd1l1	UTSW	15	44523649	missense	probably benign	0.45
R4184:Pkhd1l1	UTSW	15	44591906	missense	probably benign	0.00
R4369:Pkhd1l1	UTSW	15	44505553	missense	probably benign	0.00
R4462:Pkhd1l1	UTSW	15	44581804	missense	probably damaging	1.00
R4551:Pkhd1l1	UTSW	15	44550885	missense	probably damaging	1.00
R4618:Pkhd1l1	UTSW	15	44539682	missense	probably damaging	1.00
R4632:Pkhd1l1	UTSW	15	44484400	missense	probably benign	0.07
R4657:Pkhd1l1	UTSW	15	44547347	missense	probably damaging	1.00
R4716:Pkhd1l1	UTSW	15	44556032	missense	probably damaging	1.00
R4788:Pkhd1l1	UTSW	15	44498021	missense	probably damaging	0.99
R4828:Pkhd1l1	UTSW	15	44529405	missense	possibly damaging	0.55
R4858:Pkhd1l1	UTSW	15	44491101	missense	probably damaging	0.99
R4860:Pkhd1l1	UTSW	15	44537378	missense	possibly damaging	0.77
R4860:Pkhd1l1	UTSW	15	44537378	missense	possibly damaging	0.77
R4951:Pkhd1l1	UTSW	15	44533891	missense	possibly damaging	0.82
R4963:Pkhd1l1	UTSW	15	44504025	missense	probably benign	0.00
R5023:Pkhd1l1	UTSW	15	44528191	missense	probably benign	0.44
R5023:Pkhd1l1	UTSW	15	44582227	missense	probably benign	0.00
R5035:Pkhd1l1	UTSW	15	44568324	missense	probably damaging	1.00
R5049:Pkhd1l1	UTSW	15	44457616	missense	probably benign	0.00
R5065:Pkhd1l1	UTSW	15	44582293	missense	possibly damaging	0.68
R5089:Pkhd1l1	UTSW	15	44591887	missense	probably benign	0.01
R5151:Pkhd1l1	UTSW	15	44505309	missense	probably benign	0.00
R5153:Pkhd1l1	UTSW	15	44505309	missense	probably benign	0.00
R5189:Pkhd1l1	UTSW	15	44547148	missense	probably damaging	1.00
R5204:Pkhd1l1	UTSW	15	44547041	missense	possibly damaging	0.51
R5216:Pkhd1l1	UTSW	15	44495647	nonsense	probably null
R5286:Pkhd1l1	UTSW	15	44514972	nonsense	probably null
R5292:Pkhd1l1	UTSW	15	44529566	missense	probably damaging	1.00
R5293:Pkhd1l1	UTSW	15	44535750	missense	probably benign	0.01
R5298:Pkhd1l1	UTSW	15	44504046	missense	probably benign	0.00
R5327:Pkhd1l1	UTSW	15	44546862	missense	probably damaging	1.00
R5346:Pkhd1l1	UTSW	15	44540967	missense	probably damaging	1.00
R5481:Pkhd1l1	UTSW	15	44558646	missense	probably damaging	1.00
R5645:Pkhd1l1	UTSW	15	44532992	missense	probably benign	0.18
R5718:Pkhd1l1	UTSW	15	44545417	missense	probably damaging	1.00
R5809:Pkhd1l1	UTSW	15	44519707	missense	probably benign	0.03
R5816:Pkhd1l1	UTSW	15	44566322	missense	probably benign	0.01
R5854:Pkhd1l1	UTSW	15	44581790	missense	probably damaging	1.00
R5876:Pkhd1l1	UTSW	15	44578588	missense	possibly damaging	0.51
R5909:Pkhd1l1	UTSW	15	44526763	missense	probably damaging	1.00
R5950:Pkhd1l1	UTSW	15	44532965	missense	probably benign	0.00
R5961:Pkhd1l1	UTSW	15	44459463	missense	probably damaging	1.00
R5972:Pkhd1l1	UTSW	15	44545416	missense	probably damaging	1.00
R5975:Pkhd1l1	UTSW	15	44525988	missense	probably damaging	1.00
R5982:Pkhd1l1	UTSW	15	44489504	splice site	probably null
R6066:Pkhd1l1	UTSW	15	44528129	missense	probably damaging	0.99
R6122:Pkhd1l1	UTSW	15	44557940	missense	probably damaging	1.00
R6248:Pkhd1l1	UTSW	15	44529559	missense	probably benign
R6294:Pkhd1l1	UTSW	15	44570028	missense	probably damaging	1.00
R6301:Pkhd1l1	UTSW	15	44589525	missense	probably damaging	0.99
R6526:Pkhd1l1	UTSW	15	44498089	critical splice donor site	probably null
R6707:Pkhd1l1	UTSW	15	44529143	missense	probably benign
R6736:Pkhd1l1	UTSW	15	44557940	missense	probably damaging	1.00
R6753:Pkhd1l1	UTSW	15	44589663	missense	probably benign	0.45
R6815:Pkhd1l1	UTSW	15	44562655	missense	probably damaging	1.00
R6874:Pkhd1l1	UTSW	15	44589527	missense	probably benign	0.06
R6942:Pkhd1l1	UTSW	15	44522629	missense	probably damaging	1.00
R6970:Pkhd1l1	UTSW	15	44511674	missense	possibly damaging	0.61
R6982:Pkhd1l1	UTSW	15	44566268	missense	probably damaging	0.97
R7103:Pkhd1l1	UTSW	15	44573631	missense	probably benign	0.02
R7116:Pkhd1l1	UTSW	15	44557976	missense	probably benign	0.00
R7135:Pkhd1l1	UTSW	15	44584978	critical splice donor site	probably null
R7143:Pkhd1l1	UTSW	15	44573637	missense	possibly damaging	0.93
R7177:Pkhd1l1	UTSW	15	44467404	missense	probably damaging	1.00
R7194:Pkhd1l1	UTSW	15	44529116	missense	probably damaging	1.00
R7204:Pkhd1l1	UTSW	15	44523553	missense	possibly damaging	0.90
R7215:Pkhd1l1	UTSW	15	44528163	missense	possibly damaging	0.78
R7218:Pkhd1l1	UTSW	15	44522695	missense	possibly damaging	0.49
R7225:Pkhd1l1	UTSW	15	44546941	missense	probably damaging	1.00
R7283:Pkhd1l1	UTSW	15	44503280	missense	probably benign	0.10
R7292:Pkhd1l1	UTSW	15	44498590	missense	probably benign
R7304:Pkhd1l1	UTSW	15	44498482	missense	possibly damaging	0.94
R7349:Pkhd1l1	UTSW	15	44514954	missense	probably damaging	1.00
R7359:Pkhd1l1	UTSW	15	44589486	missense	probably damaging	1.00
R7407:Pkhd1l1	UTSW	15	44595011	missense	possibly damaging	0.75
R7475:Pkhd1l1	UTSW	15	44505185	nonsense	probably null
R7481:Pkhd1l1	UTSW	15	44512911	missense	probably benign
R7554:Pkhd1l1	UTSW	15	44495470	missense	probably damaging	1.00
R7555:Pkhd1l1	UTSW	15	44550761	missense	possibly damaging	0.51
R7562:Pkhd1l1	UTSW	15	44514930	missense	possibly damaging	0.68
R7583:Pkhd1l1	UTSW	15	44568364	critical splice donor site	probably null
R7595:Pkhd1l1	UTSW	15	44495521	missense	probably damaging	1.00
R7749:Pkhd1l1	UTSW	15	44527737	missense	probably benign	0.00
R7754:Pkhd1l1	UTSW	15	44586408	missense	possibly damaging	0.94
R7761:Pkhd1l1	UTSW	15	44529884	missense	probably benign	0.00
R7774:Pkhd1l1	UTSW	15	44540907	missense	probably benign	0.03
R7785:Pkhd1l1	UTSW	15	44543569	missense	probably damaging	1.00
R7790:Pkhd1l1	UTSW	15	44578581	missense	probably damaging	1.00
R7804:Pkhd1l1	UTSW	15	44597138	nonsense	probably null
R7864:Pkhd1l1	UTSW	15	44526053	critical splice donor site	probably null
R7883:Pkhd1l1	UTSW	15	44529126	missense	probably damaging	1.00
R8031:Pkhd1l1	UTSW	15	44512834	missense	probably damaging	1.00
R8128:Pkhd1l1	UTSW	15	44498053	missense	possibly damaging	0.94
R8142:Pkhd1l1	UTSW	15	44514931	missense	probably benign	0.00
R8150:Pkhd1l1	UTSW	15	44546659	missense	possibly damaging	0.68
R8209:Pkhd1l1	UTSW	15	44574407	missense	possibly damaging	0.46
R8212:Pkhd1l1	UTSW	15	44499300	missense	probably benign	0.12
R8226:Pkhd1l1	UTSW	15	44574407	missense	possibly damaging	0.46
R8248:Pkhd1l1	UTSW	15	44543546	missense	probably damaging	0.99
R8299:Pkhd1l1	UTSW	15	44581934	missense	probably benign	0.26
R8425:Pkhd1l1	UTSW	15	44574515	missense	probably benign	0.01
R8485:Pkhd1l1	UTSW	15	44560400	missense	probably damaging	0.98
R8486:Pkhd1l1	UTSW	15	44547416	missense	probably damaging	1.00
R8701:Pkhd1l1	UTSW	15	44574683	missense	probably damaging	1.00
R8709:Pkhd1l1	UTSW	15	44518174	missense	probably benign	0.01
R8777:Pkhd1l1	UTSW	15	44498571	missense	probably damaging	1.00
R8777-TAIL:Pkhd1l1	UTSW	15	44498571	missense	probably damaging	1.00
R8845:Pkhd1l1	UTSW	15	44505254	missense	probably benign	0.30
R8846:Pkhd1l1	UTSW	15	44546962	nonsense	probably null
R8863:Pkhd1l1	UTSW	15	44569986	nonsense	probably null
R8917:Pkhd1l1	UTSW	15	44533007	missense	probably benign	0.04
R8936:Pkhd1l1	UTSW	15	44538916	missense	possibly damaging	0.94
R8962:Pkhd1l1	UTSW	15	44536895	missense	probably damaging	1.00
R8971:Pkhd1l1	UTSW	15	44529519	missense	possibly damaging	0.68
R8973:Pkhd1l1	UTSW	15	44586437	missense	probably damaging	1.00
R8982:Pkhd1l1	UTSW	15	44523673	nonsense	probably null
R8994:Pkhd1l1	UTSW	15	44547103	missense	probably damaging	0.99
R9004:Pkhd1l1	UTSW	15	44543372	missense	probably benign	0.16
R9064:Pkhd1l1	UTSW	15	44562642	missense	possibly damaging	0.93
R9173:Pkhd1l1	UTSW	15	44520756	missense	probably benign	0.09
R9185:Pkhd1l1	UTSW	15	44589623	missense	probably benign	0.01
R9213:Pkhd1l1	UTSW	15	44495478	missense	probably damaging	1.00
R9218:Pkhd1l1	UTSW	15	44520726	missense	possibly damaging	0.90
R9256:Pkhd1l1	UTSW	15	44533894	critical splice donor site	probably null
R9291:Pkhd1l1	UTSW	15	44569976	missense	probably damaging	1.00
R9309:Pkhd1l1	UTSW	15	44536893	missense	probably benign	0.00
R9319:Pkhd1l1	UTSW	15	44529578	missense	possibly damaging	0.46
R9339:Pkhd1l1	UTSW	15	44589553	missense	probably damaging	1.00
R9366:Pkhd1l1	UTSW	15	44546912	missense	probably benign	0.03
R9444:Pkhd1l1	UTSW	15	44554657	missense	probably benign	0.00
R9464:Pkhd1l1	UTSW	15	44479613	missense	probably damaging	1.00
R9525:Pkhd1l1	UTSW	15	44584926	missense	possibly damaging	0.88
R9542:Pkhd1l1	UTSW	15	44546888	missense	probably benign	0.12
R9544:Pkhd1l1	UTSW	15	44546843	missense	probably damaging	1.00
R9608:Pkhd1l1	UTSW	15	44578633	missense	possibly damaging	0.65
R9673:Pkhd1l1	UTSW	15	44523505	missense	probably benign	0.22
R9771:Pkhd1l1	UTSW	15	44495487	missense	probably benign
R9792:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
R9793:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
R9795:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
RF006:Pkhd1l1	UTSW	15	44503238	missense	probably benign	0.03
RF006:Pkhd1l1	UTSW	15	44558507	critical splice acceptor site	probably benign
RF008:Pkhd1l1	UTSW	15	44558505	critical splice acceptor site	probably benign
RF012:Pkhd1l1	UTSW	15	44558505	critical splice acceptor site	probably benign
RF019:Pkhd1l1	UTSW	15	44558507	critical splice acceptor site	probably benign
RF030:Pkhd1l1	UTSW	15	44558502	critical splice acceptor site	probably benign
RF033:Pkhd1l1	UTSW	15	44558506	critical splice acceptor site	probably benign
RF038:Pkhd1l1	UTSW	15	44558503	critical splice acceptor site	probably benign
RF046:Pkhd1l1	UTSW	15	44558495	critical splice acceptor site	probably benign
X0027:Pkhd1l1	UTSW	15	44591966	missense	probably damaging	0.99
Z1177:Pkhd1l1	UTSW	15	44573576	missense	probably damaging	0.97
Z1177:Pkhd1l1	UTSW	15	44578578	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGTAAGACCTTGAATAACTTAGTTGC -3'
(R):5'- CTTCTGAGAATCACCAGAAGAAAGC -3'

Sequencing Primer
(F):5'- GACCTTGAATAACTTAGTTGCAGATG -3'
(R):5'- AGCTCACAGAAGCCAGTATATG -3'

Posted On

2014-06-23