Incidental Mutation 'R1827:Dock10'
ID206870
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Namededicator of cytokinesis 10
SynonymsJr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3
MMRRC Submission 039854-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R1827 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location80501073-80758527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80530292 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1647 (N1647S)
Ref Sequence ENSEMBL: ENSMUSP00000077099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]
Predicted Effect probably benign
Transcript: ENSMUST00000077946
AA Change: N1647S

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: N1647S

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187774
AA Change: N1635S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: N1635S

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189486
Predicted Effect probably benign
Transcript: ENSMUST00000190595
AA Change: N1300S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608
AA Change: N1300S

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190983
AA Change: N1634S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: N1634S

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb G C 7: 131,441,275 R355T probably damaging Het
Ackr2 C T 9: 121,909,515 R319C probably benign Het
Acot4 G A 12: 84,041,938 A187T probably damaging Het
Adgrb2 A C 4: 130,012,557 Q926P probably damaging Het
Adgrb3 T C 1: 25,532,577 T420A probably damaging Het
Adra1b A T 11: 43,835,649 V147E probably damaging Het
Bco1 A G 8: 117,105,759 Y98C probably damaging Het
C87977 G A 4: 144,209,610 P27S probably damaging Het
Car5a C T 8: 121,923,808 V166M probably benign Het
Cdh5 T C 8: 104,112,909 L4P possibly damaging Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cmya5 G A 13: 93,074,448 T3279I possibly damaging Het
Col4a4 C T 1: 82,539,988 G105D unknown Het
Cyp2d34 A T 15: 82,616,094 H481Q probably benign Het
Dhx15 A T 5: 52,170,080 C307* probably null Het
Dnah9 A G 11: 65,850,061 Y4100H probably damaging Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
Esyt1 T C 10: 128,516,369 E763G probably benign Het
Fbxo18 G T 2: 11,763,888 D332E possibly damaging Het
Fndc8 G A 11: 82,899,529 V275M probably damaging Het
Focad T G 4: 88,229,383 Y420D probably benign Het
Gml A T 15: 74,816,431 H62Q probably benign Het
Gpr158 A T 2: 21,827,318 L1076F probably benign Het
Gpr161 A G 1: 165,306,567 T133A possibly damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gsg1l A T 7: 125,910,197 I256K possibly damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hnf1a G A 5: 114,960,195 A116V probably damaging Het
Hrh4 A T 18: 13,022,204 T267S probably damaging Het
Igfals A T 17: 24,880,304 N123I probably benign Het
Iglon5 T A 7: 43,479,121 T91S probably benign Het
Impg2 A T 16: 56,267,220 N1134I possibly damaging Het
Incenp A G 19: 9,872,729 V860A possibly damaging Het
Irf5 A T 6: 29,536,673 H461L possibly damaging Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kank2 A G 9: 21,795,465 S86P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnn3 A T 3: 89,520,994 M176L possibly damaging Het
Mccc1 A T 3: 35,985,001 I281N probably damaging Het
Mms19 G A 19: 41,953,677 A584V probably benign Het
Mon2 A T 10: 123,046,311 D184E probably damaging Het
Mrpl1 T C 5: 96,226,343 V159A possibly damaging Het
Myo18a C T 11: 77,818,771 T190I probably benign Het
Myo7a A T 7: 98,076,731 M1038K probably damaging Het
Myrfl T A 10: 116,832,947 I304F probably damaging Het
Neo1 G A 9: 58,917,031 R705* probably null Het
Nfat5 T C 8: 107,367,334 S736P probably benign Het
Nlrp4c C T 7: 6,065,766 P222L probably damaging Het
Nmt1 T A 11: 103,064,838 W481R probably damaging Het
Ntrk3 T A 7: 78,247,301 I663L probably damaging Het
Nup210l A T 3: 90,154,557 E681V probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr504 A T 7: 108,565,075 V240D probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pald1 ATGCTGCTGCTGCTGC ATGCTGCTGCTGC 10: 61,355,922 probably benign Het
Ppm1e T C 11: 87,231,695 T479A probably damaging Het
Ppp1r7 A G 1: 93,360,796 E298G probably benign Het
Prkaca T C 8: 83,990,987 probably null Het
Prss36 A G 7: 127,933,492 V718A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rrp12 G C 19: 41,880,481 D519E possibly damaging Het
Rufy4 T C 1: 74,134,120 L415P probably damaging Het
Ryk T A 9: 102,888,507 D335E probably benign Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Scin T C 12: 40,068,923 R625G possibly damaging Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Skiv2l2 C A 13: 112,913,099 probably null Het
Slc28a1 T C 7: 81,138,202 V279A possibly damaging Het
Slc30a8 T A 15: 52,331,557 probably null Het
Slco6d1 A G 1: 98,421,216 D4G probably damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Trpm1 G A 7: 64,235,007 R812H probably damaging Het
Tsga10 T A 1: 37,835,580 I75F probably damaging Het
Tyms C T 5: 30,062,016 probably null Het
Ubr4 A G 4: 139,425,697 probably null Het
Unc45a A G 7: 80,331,740 V438A possibly damaging Het
Usf2 T C 7: 30,955,340 D110G probably damaging Het
Vit T C 17: 78,546,446 probably null Het
Vmn2r104 A T 17: 20,042,235 M211K probably damaging Het
Vmn2r11 T C 5: 109,052,072 H505R probably benign Het
Vmn2r77 G A 7: 86,801,613 A236T probably damaging Het
Xpo1 T C 11: 23,285,155 M608T probably benign Het
Zfp112 T C 7: 24,124,960 F116L probably damaging Het
Zfp84 A G 7: 29,777,343 T487A possibly damaging Het
Zfpl1 A C 19: 6,081,871 L241R probably benign Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80585012 missense probably damaging 1.00
IGL00783:Dock10 APN 1 80572449 splice site probably benign
IGL00784:Dock10 APN 1 80572449 splice site probably benign
IGL00858:Dock10 APN 1 80568003 missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80531245 missense probably damaging 1.00
IGL01351:Dock10 APN 1 80593159 missense probably damaging 1.00
IGL01356:Dock10 APN 1 80523742 missense probably damaging 1.00
IGL01584:Dock10 APN 1 80533850 missense probably damaging 0.99
IGL01619:Dock10 APN 1 80634298 splice site probably benign
IGL01678:Dock10 APN 1 80543352 missense probably damaging 1.00
IGL01759:Dock10 APN 1 80526273 missense probably damaging 1.00
IGL02238:Dock10 APN 1 80533793 missense probably damaging 0.99
IGL02352:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02359:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02377:Dock10 APN 1 80584994 critical splice donor site probably null
IGL02433:Dock10 APN 1 80530188 missense probably damaging 1.00
IGL02471:Dock10 APN 1 80515622 missense probably damaging 0.99
IGL02645:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02646:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02648:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02649:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02650:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02652:Dock10 APN 1 80592844 unclassified probably null
IGL02718:Dock10 APN 1 80523818 missense probably benign 0.00
IGL02998:Dock10 APN 1 80573542 missense probably damaging 1.00
IGL03057:Dock10 APN 1 80567371 missense probably damaging 1.00
IGL03066:Dock10 APN 1 80585041 missense probably benign 0.00
IGL03106:Dock10 APN 1 80568834 missense probably damaging 0.98
IGL03148:Dock10 APN 1 80540358 missense probably benign 0.01
IGL03271:Dock10 APN 1 80505409 missense probably damaging 1.00
IGL03352:Dock10 APN 1 80606296 splice site probably benign
LCD18:Dock10 UTSW 1 80716623 intron probably benign
PIT4366001:Dock10 UTSW 1 80595721 missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80505446 missense probably damaging 1.00
R0019:Dock10 UTSW 1 80605925 missense probably damaging 1.00
R0081:Dock10 UTSW 1 80606578 missense probably damaging 0.99
R0095:Dock10 UTSW 1 80524071 missense probably benign 0.00
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0255:Dock10 UTSW 1 80605876 missense probably damaging 1.00
R0267:Dock10 UTSW 1 80512454 missense probably damaging 1.00
R0299:Dock10 UTSW 1 80536929 missense probably damaging 0.99
R0365:Dock10 UTSW 1 80595683 missense probably damaging 1.00
R0387:Dock10 UTSW 1 80540276 missense probably damaging 1.00
R0403:Dock10 UTSW 1 80524070 missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80540476 missense probably benign 0.03
R0414:Dock10 UTSW 1 80535933 missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80541219 splice site probably benign
R0698:Dock10 UTSW 1 80530178 missense probably damaging 1.00
R0711:Dock10 UTSW 1 80523975 missense probably damaging 1.00
R0925:Dock10 UTSW 1 80536940 missense probably benign 0.20
R1162:Dock10 UTSW 1 80568842 missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80540343 missense probably damaging 1.00
R1440:Dock10 UTSW 1 80549136 missense probably benign 0.03
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1525:Dock10 UTSW 1 80606164 critical splice donor site probably null
R1544:Dock10 UTSW 1 80592635 missense probably benign 0.00
R1601:Dock10 UTSW 1 80549802 missense probably benign 0.00
R1757:Dock10 UTSW 1 80533869 missense probably damaging 1.00
R1765:Dock10 UTSW 1 80605823 missense probably damaging 1.00
R1783:Dock10 UTSW 1 80574180 missense probably benign 0.17
R1823:Dock10 UTSW 1 80543097 splice site probably null
R1844:Dock10 UTSW 1 80543201 missense probably damaging 0.99
R1856:Dock10 UTSW 1 80606568 missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80510426 missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80549789 missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80505642 missense probably damaging 1.00
R2112:Dock10 UTSW 1 80505643 missense probably damaging 0.99
R2113:Dock10 UTSW 1 80606563 missense probably damaging 1.00
R2439:Dock10 UTSW 1 80532432 missense probably damaging 1.00
R2566:Dock10 UTSW 1 80540253 missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80532357 missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80536926 missense probably damaging 0.99
R3768:Dock10 UTSW 1 80532368 missense probably damaging 1.00
R4009:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R4016:Dock10 UTSW 1 80606569 missense probably damaging 1.00
R4179:Dock10 UTSW 1 80510417 missense probably benign 0.00
R4243:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4244:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4245:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4674:Dock10 UTSW 1 80606620 missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80515613 missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80541281 missense probably damaging 1.00
R4851:Dock10 UTSW 1 80549157 missense probably benign 0.33
R4911:Dock10 UTSW 1 80606236 missense probably damaging 1.00
R4976:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5086:Dock10 UTSW 1 80551472 missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5301:Dock10 UTSW 1 80648256 missense probably benign 0.41
R5404:Dock10 UTSW 1 80503913 intron probably benign
R5457:Dock10 UTSW 1 80524064 missense probably damaging 1.00
R5790:Dock10 UTSW 1 80505170 missense probably benign 0.00
R5845:Dock10 UTSW 1 80505742 intron probably benign
R5871:Dock10 UTSW 1 80541340 critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80574138 missense probably damaging 1.00
R5881:Dock10 UTSW 1 80560923 missense probably benign 0.19
R5895:Dock10 UTSW 1 80536959 missense probably benign
R5935:Dock10 UTSW 1 80505587 intron probably benign
R5965:Dock10 UTSW 1 80568744 splice site probably null
R5966:Dock10 UTSW 1 80568508 missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80606173 missense probably damaging 0.98
R6029:Dock10 UTSW 1 80536946 missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R6145:Dock10 UTSW 1 80575904 nonsense probably null
R6257:Dock10 UTSW 1 80503696 intron probably benign
R6274:Dock10 UTSW 1 80538823 missense probably damaging 1.00
R6324:Dock10 UTSW 1 80505176 missense probably benign 0.03
R6346:Dock10 UTSW 1 80575856 splice site probably null
R6476:Dock10 UTSW 1 80541242 nonsense probably null
R6516:Dock10 UTSW 1 80540461 missense probably damaging 1.00
R6526:Dock10 UTSW 1 80586351 missense probably damaging 0.97
R6534:Dock10 UTSW 1 80503671 missense probably benign 0.01
R6620:Dock10 UTSW 1 80592638 missense probably benign 0.01
R6640:Dock10 UTSW 1 80533838 nonsense probably null
R6669:Dock10 UTSW 1 80592855 missense probably damaging 1.00
R6672:Dock10 UTSW 1 80512531 missense probably benign 0.00
R6679:Dock10 UTSW 1 80566797 missense probably benign 0.11
R6682:Dock10 UTSW 1 80512621 missense probably damaging 1.00
R6712:Dock10 UTSW 1 80536866 missense probably benign 0.00
R6726:Dock10 UTSW 1 80512430 missense probably damaging 1.00
R6788:Dock10 UTSW 1 80531245 missense probably damaging 1.00
R6805:Dock10 UTSW 1 80586690 missense probably benign
R6815:Dock10 UTSW 1 80538859 missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80615365 missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80531259 missense probably damaging 1.00
R6964:Dock10 UTSW 1 80503648 intron probably benign
R7026:Dock10 UTSW 1 80501787 missense probably benign 0.40
R7084:Dock10 UTSW 1 80503856 missense
R7087:Dock10 UTSW 1 80592826 missense probably benign
R7158:Dock10 UTSW 1 80586872 critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80540331 missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80568529 missense probably benign 0.01
R7255:Dock10 UTSW 1 80543099 critical splice donor site probably null
R7320:Dock10 UTSW 1 80549704 critical splice donor site probably null
R7359:Dock10 UTSW 1 80709348 missense probably benign 0.01
R7423:Dock10 UTSW 1 80523780 missense possibly damaging 0.67
R7464:Dock10 UTSW 1 80540315 missense probably damaging 0.99
R7483:Dock10 UTSW 1 80515566 missense probably benign 0.01
R7487:Dock10 UTSW 1 80585048 missense probably benign 0.00
X0025:Dock10 UTSW 1 80536920 missense probably damaging 0.98
X0065:Dock10 UTSW 1 80541260 missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80532347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGGTCTCCATTTCTTGC -3'
(R):5'- AGACAGTAAAGTTGACCATGCTTC -3'

Sequencing Primer
(F):5'- GCATGAATCTTGGCCATGC -3'
(R):5'- AAGTTGACCATGCTTCTTATTACC -3'
Posted On2014-06-23