Mutagenetix > Incidental Mutation

Incidental Mutation 'R1827:Trpm1'

206907

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

039854-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1827 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64235007 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 812 (R812H)

Ref Sequence

ENSEMBL: ENSMUSP00000146226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: R812H

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: R812H

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000107525
AA Change: R812H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: R812H

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205939

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: R696H

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: R812H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadsb	G	C	7: 131,441,275	R355T	probably damaging	Het
Ackr2	C	T	9: 121,909,515	R319C	probably benign	Het
Acot4	G	A	12: 84,041,938	A187T	probably damaging	Het
Adgrb2	A	C	4: 130,012,557	Q926P	probably damaging	Het
Adgrb3	T	C	1: 25,532,577	T420A	probably damaging	Het
Adra1b	A	T	11: 43,835,649	V147E	probably damaging	Het
Bco1	A	G	8: 117,105,759	Y98C	probably damaging	Het
C87977	G	A	4: 144,209,610	P27S	probably damaging	Het
Car5a	C	T	8: 121,923,808	V166M	probably benign	Het
Cdh5	T	C	8: 104,112,909	L4P	possibly damaging	Het
Clec12a	A	G	6: 129,353,799	T115A	probably damaging	Het
Cmya5	G	A	13: 93,074,448	T3279I	possibly damaging	Het
Col4a4	C	T	1: 82,539,988	G105D	unknown	Het
Cyp2d34	A	T	15: 82,616,094	H481Q	probably benign	Het
Dhx15	A	T	5: 52,170,080	C307*	probably null	Het
Dnah9	A	G	11: 65,850,061	Y4100H	probably damaging	Het
Dock10	T	C	1: 80,530,292	N1647S	probably benign	Het
Duox1	T	A	2: 122,347,380	Y1548*	probably null	Het
Esyt1	T	C	10: 128,516,369	E763G	probably benign	Het
Fbxo18	G	T	2: 11,763,888	D332E	possibly damaging	Het
Fndc8	G	A	11: 82,899,529	V275M	probably damaging	Het
Focad	T	G	4: 88,229,383	Y420D	probably benign	Het
Gml	A	T	15: 74,816,431	H62Q	probably benign	Het
Gpr158	A	T	2: 21,827,318	L1076F	probably benign	Het
Gpr161	A	G	1: 165,306,567	T133A	possibly damaging	Het
Gpr83	G	T	9: 14,868,333	C269F	possibly damaging	Het
Gsg1l	A	T	7: 125,910,197	I256K	possibly damaging	Het
Hao1	T	A	2: 134,530,664	R141S	probably benign	Het
Hnf1a	G	A	5: 114,960,195	A116V	probably damaging	Het
Hrh4	A	T	18: 13,022,204	T267S	probably damaging	Het
Igfals	A	T	17: 24,880,304	N123I	probably benign	Het
Iglon5	T	A	7: 43,479,121	T91S	probably benign	Het
Impg2	A	T	16: 56,267,220	N1134I	possibly damaging	Het
Incenp	A	G	19: 9,872,729	V860A	possibly damaging	Het
Irf5	A	T	6: 29,536,673	H461L	possibly damaging	Het
Itpr2	A	G	6: 146,328,332	L1255P	probably damaging	Het
Kank2	A	G	9: 21,795,465	S86P	probably damaging	Het
Kcnma1	C	A	14: 23,330,929	D903Y	probably damaging	Het
Kcnn3	A	T	3: 89,520,994	M176L	possibly damaging	Het
Mccc1	A	T	3: 35,985,001	I281N	probably damaging	Het
Mms19	G	A	19: 41,953,677	A584V	probably benign	Het
Mon2	A	T	10: 123,046,311	D184E	probably damaging	Het
Mrpl1	T	C	5: 96,226,343	V159A	possibly damaging	Het
Myo18a	C	T	11: 77,818,771	T190I	probably benign	Het
Myo7a	A	T	7: 98,076,731	M1038K	probably damaging	Het
Myrfl	T	A	10: 116,832,947	I304F	probably damaging	Het
Neo1	G	A	9: 58,917,031	R705*	probably null	Het
Nfat5	T	C	8: 107,367,334	S736P	probably benign	Het
Nlrp4c	C	T	7: 6,065,766	P222L	probably damaging	Het
Nmt1	T	A	11: 103,064,838	W481R	probably damaging	Het
Ntrk3	T	A	7: 78,247,301	I663L	probably damaging	Het
Nup210l	A	T	3: 90,154,557	E681V	probably damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr1202	A	T	2: 88,818,058	I296F	probably benign	Het
Olfr504	A	T	7: 108,565,075	V240D	probably benign	Het
Olfr543	A	G	7: 102,477,513	L119P	probably damaging	Het
Pald1	ATGCTGCTGCTGCTGC	ATGCTGCTGCTGC	10: 61,355,922		probably benign	Het
Ppm1e	T	C	11: 87,231,695	T479A	probably damaging	Het
Ppp1r7	A	G	1: 93,360,796	E298G	probably benign	Het
Prkaca	T	C	8: 83,990,987		probably null	Het
Prss36	A	G	7: 127,933,492	V718A	probably damaging	Het
Pxk	C	T	14: 8,151,507	R441*	probably null	Het
Rnf182	G	A	13: 43,668,534	W187*	probably null	Het
Rrp12	G	C	19: 41,880,481	D519E	possibly damaging	Het
Rufy4	T	C	1: 74,134,120	L415P	probably damaging	Het
Ryk	T	A	9: 102,888,507	D335E	probably benign	Het
S100a11	A	T	3: 93,526,121	I91F	probably benign	Het
Scin	T	C	12: 40,068,923	R625G	possibly damaging	Het
Simc1	T	A	13: 54,524,639	C267S	probably benign	Het
Skiv2l2	C	A	13: 112,913,099		probably null	Het
Slc28a1	T	C	7: 81,138,202	V279A	possibly damaging	Het
Slc30a8	T	A	15: 52,331,557		probably null	Het
Slco6d1	A	G	1: 98,421,216	D4G	probably damaging	Het
Tmem127	G	A	2: 127,256,174		probably null	Het
Tsga10	T	A	1: 37,835,580	I75F	probably damaging	Het
Tyms	C	T	5: 30,062,016		probably null	Het
Ubr4	A	G	4: 139,425,697		probably null	Het
Unc45a	A	G	7: 80,331,740	V438A	possibly damaging	Het
Usf2	T	C	7: 30,955,340	D110G	probably damaging	Het
Vit	T	C	17: 78,546,446		probably null	Het
Vmn2r104	A	T	17: 20,042,235	M211K	probably damaging	Het
Vmn2r11	T	C	5: 109,052,072	H505R	probably benign	Het
Vmn2r77	G	A	7: 86,801,613	A236T	probably damaging	Het
Xpo1	T	C	11: 23,285,155	M608T	probably benign	Het
Zfp112	T	C	7: 24,124,960	F116L	probably damaging	Het
Zfp84	A	G	7: 29,777,343	T487A	possibly damaging	Het
Zfpl1	A	C	19: 6,081,871	L241R	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGGATGTGAGCTGCTTTGCC -3'
(R):5'- GGAAAACTCTCCAAGTGCCC -3'

Sequencing Primer
(F):5'- AACAAGTCTTTCCTCCTAGAACTTG -3'
(R):5'- AAGTGCCCCTGTTAGCAAG -3'

Posted On

2014-06-23