Incidental Mutation 'R1827:Nfat5'
ID206921
Institutional Source Beutler Lab
Gene Symbol Nfat5
Ensembl Gene ENSMUSG00000003847
Gene Namenuclear factor of activated T cells 5
SynonymsOREBP, nfatz, TonEBP, B130038B15Rik
MMRRC Submission 039854-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R1827 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location107293470-107379517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107367334 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 736 (S736P)
Ref Sequence ENSEMBL: ENSMUSP00000127784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075922] [ENSMUST00000077440] [ENSMUST00000125721] [ENSMUST00000133026] [ENSMUST00000144100] [ENSMUST00000147588] [ENSMUST00000151114] [ENSMUST00000154474] [ENSMUST00000169453]
Predicted Effect probably benign
Transcript: ENSMUST00000075922
AA Change: S718P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075311
Gene: ENSMUSG00000003847
AA Change: S718P

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 7.8e-23 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077440
AA Change: S642P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076653
Gene: ENSMUSG00000003847
AA Change: S642P

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:RHD 206 363 1.5e-22 PFAM
IPT 368 466 3.33e-15 SMART
low complexity region 571 577 N/A INTRINSIC
low complexity region 658 678 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 839 844 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
internal_repeat_2 927 1110 7.13e-8 PROSPERO
internal_repeat_1 935 1128 2.59e-11 PROSPERO
internal_repeat_2 1122 1324 7.13e-8 PROSPERO
internal_repeat_1 1207 1426 2.59e-11 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000125721
AA Change: S718P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116094
Gene: ENSMUSG00000003847
AA Change: S718P

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 1e-22 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
internal_repeat_2 1003 1186 2.22e-8 PROSPERO
internal_repeat_1 1011 1204 5.31e-12 PROSPERO
internal_repeat_2 1198 1400 2.22e-8 PROSPERO
internal_repeat_1 1283 1502 5.31e-12 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126397
Predicted Effect probably benign
Transcript: ENSMUST00000133026
SMART Domains Protein: ENSMUSP00000116631
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 70 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144100
Predicted Effect probably benign
Transcript: ENSMUST00000147588
AA Change: S217P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122871
Gene: ENSMUSG00000003847
AA Change: S217P

DomainStartEndE-ValueType
Blast:IPT 1 42 3e-20 BLAST
PDB:1IMH|D 1 44 2e-20 PDB
SCOP:d1bfta_ 1 44 3e-14 SMART
low complexity region 146 152 N/A INTRINSIC
low complexity region 233 253 N/A INTRINSIC
low complexity region 292 309 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
low complexity region 414 419 N/A INTRINSIC
low complexity region 462 476 N/A INTRINSIC
internal_repeat_2 502 685 1.17e-6 PROSPERO
internal_repeat_1 510 703 1.39e-9 PROSPERO
internal_repeat_2 697 899 1.17e-6 PROSPERO
internal_repeat_1 782 1001 1.39e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000151114
AA Change: S736P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119370
Gene: ENSMUSG00000003847
AA Change: S736P

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000154474
SMART Domains Protein: ENSMUSP00000115036
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169453
AA Change: S736P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127784
Gene: ENSMUSG00000003847
AA Change: S736P

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells family of transcription factors. Proteins belonging to this family play a central role in inducible gene transcription during the immune response. This protein regulates gene expression induced by osmotic stress in mammalian cells. Unlike monomeric members of this protein family, this protein exists as a homodimer and forms stable dimers with DNA elements. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one of several knock-out allele exhibit lethality between E14.5 and E17.5 as well as around P10 with kidney, cardiac or immune defects depending on the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb G C 7: 131,441,275 R355T probably damaging Het
Ackr2 C T 9: 121,909,515 R319C probably benign Het
Acot4 G A 12: 84,041,938 A187T probably damaging Het
Adgrb2 A C 4: 130,012,557 Q926P probably damaging Het
Adgrb3 T C 1: 25,532,577 T420A probably damaging Het
Adra1b A T 11: 43,835,649 V147E probably damaging Het
Bco1 A G 8: 117,105,759 Y98C probably damaging Het
C87977 G A 4: 144,209,610 P27S probably damaging Het
Car5a C T 8: 121,923,808 V166M probably benign Het
Cdh5 T C 8: 104,112,909 L4P possibly damaging Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cmya5 G A 13: 93,074,448 T3279I possibly damaging Het
Col4a4 C T 1: 82,539,988 G105D unknown Het
Cyp2d34 A T 15: 82,616,094 H481Q probably benign Het
Dhx15 A T 5: 52,170,080 C307* probably null Het
Dnah9 A G 11: 65,850,061 Y4100H probably damaging Het
Dock10 T C 1: 80,530,292 N1647S probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
Esyt1 T C 10: 128,516,369 E763G probably benign Het
Fbxo18 G T 2: 11,763,888 D332E possibly damaging Het
Fndc8 G A 11: 82,899,529 V275M probably damaging Het
Focad T G 4: 88,229,383 Y420D probably benign Het
Gml A T 15: 74,816,431 H62Q probably benign Het
Gpr158 A T 2: 21,827,318 L1076F probably benign Het
Gpr161 A G 1: 165,306,567 T133A possibly damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gsg1l A T 7: 125,910,197 I256K possibly damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hnf1a G A 5: 114,960,195 A116V probably damaging Het
Hrh4 A T 18: 13,022,204 T267S probably damaging Het
Igfals A T 17: 24,880,304 N123I probably benign Het
Iglon5 T A 7: 43,479,121 T91S probably benign Het
Impg2 A T 16: 56,267,220 N1134I possibly damaging Het
Incenp A G 19: 9,872,729 V860A possibly damaging Het
Irf5 A T 6: 29,536,673 H461L possibly damaging Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kank2 A G 9: 21,795,465 S86P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnn3 A T 3: 89,520,994 M176L possibly damaging Het
Mccc1 A T 3: 35,985,001 I281N probably damaging Het
Mms19 G A 19: 41,953,677 A584V probably benign Het
Mon2 A T 10: 123,046,311 D184E probably damaging Het
Mrpl1 T C 5: 96,226,343 V159A possibly damaging Het
Myo18a C T 11: 77,818,771 T190I probably benign Het
Myo7a A T 7: 98,076,731 M1038K probably damaging Het
Myrfl T A 10: 116,832,947 I304F probably damaging Het
Neo1 G A 9: 58,917,031 R705* probably null Het
Nlrp4c C T 7: 6,065,766 P222L probably damaging Het
Nmt1 T A 11: 103,064,838 W481R probably damaging Het
Ntrk3 T A 7: 78,247,301 I663L probably damaging Het
Nup210l A T 3: 90,154,557 E681V probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr504 A T 7: 108,565,075 V240D probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pald1 ATGCTGCTGCTGCTGC ATGCTGCTGCTGC 10: 61,355,922 probably benign Het
Ppm1e T C 11: 87,231,695 T479A probably damaging Het
Ppp1r7 A G 1: 93,360,796 E298G probably benign Het
Prkaca T C 8: 83,990,987 probably null Het
Prss36 A G 7: 127,933,492 V718A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rrp12 G C 19: 41,880,481 D519E possibly damaging Het
Rufy4 T C 1: 74,134,120 L415P probably damaging Het
Ryk T A 9: 102,888,507 D335E probably benign Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Scin T C 12: 40,068,923 R625G possibly damaging Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Skiv2l2 C A 13: 112,913,099 probably null Het
Slc28a1 T C 7: 81,138,202 V279A possibly damaging Het
Slc30a8 T A 15: 52,331,557 probably null Het
Slco6d1 A G 1: 98,421,216 D4G probably damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Trpm1 G A 7: 64,235,007 R812H probably damaging Het
Tsga10 T A 1: 37,835,580 I75F probably damaging Het
Tyms C T 5: 30,062,016 probably null Het
Ubr4 A G 4: 139,425,697 probably null Het
Unc45a A G 7: 80,331,740 V438A possibly damaging Het
Usf2 T C 7: 30,955,340 D110G probably damaging Het
Vit T C 17: 78,546,446 probably null Het
Vmn2r104 A T 17: 20,042,235 M211K probably damaging Het
Vmn2r11 T C 5: 109,052,072 H505R probably benign Het
Vmn2r77 G A 7: 86,801,613 A236T probably damaging Het
Xpo1 T C 11: 23,285,155 M608T probably benign Het
Zfp112 T C 7: 24,124,960 F116L probably damaging Het
Zfp84 A G 7: 29,777,343 T487A possibly damaging Het
Zfpl1 A C 19: 6,081,871 L241R probably benign Het
Other mutations in Nfat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Nfat5 APN 8 107367514 missense probably damaging 1.00
IGL01145:Nfat5 APN 8 107367215 missense probably damaging 0.99
IGL01700:Nfat5 APN 8 107339130 missense probably damaging 0.99
IGL01721:Nfat5 APN 8 107344979 critical splice donor site probably null
IGL01796:Nfat5 APN 8 107367641 missense probably damaging 1.00
IGL01976:Nfat5 APN 8 107367559 missense probably damaging 1.00
IGL02063:Nfat5 APN 8 107361818 missense probably benign 0.03
IGL02150:Nfat5 APN 8 107367952 nonsense probably null
IGL02174:Nfat5 APN 8 107339051 missense probably damaging 1.00
IGL02224:Nfat5 APN 8 107344815 missense probably benign 0.00
IGL02226:Nfat5 APN 8 107351522 nonsense probably null
IGL02324:Nfat5 APN 8 107366176 splice site probably benign
IGL02724:Nfat5 APN 8 107358735 missense probably damaging 0.97
fettfeld UTSW 8 107347727 missense probably damaging 1.00
grunefeld UTSW 8 107355508 unclassified probably null
kleinfeld UTSW 8 107351438 missense probably damaging 1.00
H8562:Nfat5 UTSW 8 107339382 splice site probably benign
R0003:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0117:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0118:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0119:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0135:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0138:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0141:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0302:Nfat5 UTSW 8 107358701 missense probably damaging 1.00
R0420:Nfat5 UTSW 8 107367461 missense probably damaging 1.00
R0613:Nfat5 UTSW 8 107366295 missense possibly damaging 0.83
R0691:Nfat5 UTSW 8 107355605 missense probably damaging 1.00
R0743:Nfat5 UTSW 8 107368066 missense probably damaging 1.00
R1329:Nfat5 UTSW 8 107369027 missense probably benign 0.42
R1550:Nfat5 UTSW 8 107370573 missense probably damaging 0.99
R1590:Nfat5 UTSW 8 107293890 missense probably damaging 1.00
R1778:Nfat5 UTSW 8 107361789 missense probably damaging 1.00
R1918:Nfat5 UTSW 8 107366236 missense probably damaging 0.97
R2679:Nfat5 UTSW 8 107344914 missense probably damaging 1.00
R2850:Nfat5 UTSW 8 107293860 missense probably damaging 1.00
R3703:Nfat5 UTSW 8 107351421 splice site probably benign
R3966:Nfat5 UTSW 8 107367289 missense possibly damaging 0.47
R4301:Nfat5 UTSW 8 107355695 intron probably benign
R4596:Nfat5 UTSW 8 107351500 missense possibly damaging 0.93
R4602:Nfat5 UTSW 8 107367223 nonsense probably null
R4627:Nfat5 UTSW 8 107369276 missense probably damaging 1.00
R4917:Nfat5 UTSW 8 107324652 missense probably damaging 1.00
R4918:Nfat5 UTSW 8 107324652 missense probably damaging 1.00
R5089:Nfat5 UTSW 8 107351438 missense probably damaging 1.00
R5495:Nfat5 UTSW 8 107368447 missense probably benign 0.03
R5566:Nfat5 UTSW 8 107369135 missense possibly damaging 0.47
R5851:Nfat5 UTSW 8 107347727 missense probably damaging 1.00
R6012:Nfat5 UTSW 8 107367133 missense probably benign 0.09
R6018:Nfat5 UTSW 8 107355651 critical splice donor site probably null
R6364:Nfat5 UTSW 8 107368277 missense probably benign 0.00
R6404:Nfat5 UTSW 8 107370588 missense probably benign 0.01
R6466:Nfat5 UTSW 8 107355508 unclassified probably null
R7056:Nfat5 UTSW 8 107368106 missense probably damaging 1.00
R7105:Nfat5 UTSW 8 107369191 missense possibly damaging 0.88
R7128:Nfat5 UTSW 8 107358691 missense probably benign 0.10
R7214:Nfat5 UTSW 8 107293883 missense probably damaging 0.99
R7276:Nfat5 UTSW 8 107367099 missense probably benign 0.25
R7560:Nfat5 UTSW 8 107370589 missense probably benign 0.15
X0022:Nfat5 UTSW 8 107347756 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCTTCCCACTTAACTCCTGAAAG -3'
(R):5'- GCTGCCTGTGAAACTTCCTG -3'

Sequencing Primer
(F):5'- CTTAACTCCTGAAAGTGAGAATCAGC -3'
(R):5'- GCTTGCAGCTGCTGAATAGTACTC -3'
Posted On2014-06-23