Incidental Mutation 'R1827:Gpr83'
ID206924
Institutional Source Beutler Lab
Gene Symbol Gpr83
Ensembl Gene ENSMUSG00000031932
Gene NameG protein-coupled receptor 83
SynonymsRP82, GIR, Gir, glucocorticoid-induced receptor, RP39, Gpr72, RP105
MMRRC Submission 039854-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1827 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location14860210-14870789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 14868333 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 269 (C269F)
Ref Sequence ENSEMBL: ENSMUSP00000034408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034408] [ENSMUST00000115624]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034408
AA Change: C269F

PolyPhen 2 Score 0.531 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034408
Gene: ENSMUSG00000031932
AA Change: C269F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:7tm_4 78 271 2.4e-8 PFAM
Pfam:7TM_GPCR_Srsx 82 360 6.6e-16 PFAM
Pfam:7tm_1 88 345 9e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115624
AA Change: C227F

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111287
Gene: ENSMUSG00000031932
AA Change: C227F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:7tm_1 88 133 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 128 318 1.8e-6 PFAM
Pfam:7tm_1 129 303 1.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133278
Meta Mutation Damage Score 0.1579 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal regulatory T cell development. Mice homozygous for a different targeted allele exhibit attenuated stress-evoked anxiety, increased sucrose preference and delayed spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb G C 7: 131,441,275 R355T probably damaging Het
Ackr2 C T 9: 121,909,515 R319C probably benign Het
Acot4 G A 12: 84,041,938 A187T probably damaging Het
Adgrb2 A C 4: 130,012,557 Q926P probably damaging Het
Adgrb3 T C 1: 25,532,577 T420A probably damaging Het
Adra1b A T 11: 43,835,649 V147E probably damaging Het
Bco1 A G 8: 117,105,759 Y98C probably damaging Het
C87977 G A 4: 144,209,610 P27S probably damaging Het
Car5a C T 8: 121,923,808 V166M probably benign Het
Cdh5 T C 8: 104,112,909 L4P possibly damaging Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cmya5 G A 13: 93,074,448 T3279I possibly damaging Het
Col4a4 C T 1: 82,539,988 G105D unknown Het
Cyp2d34 A T 15: 82,616,094 H481Q probably benign Het
Dhx15 A T 5: 52,170,080 C307* probably null Het
Dnah9 A G 11: 65,850,061 Y4100H probably damaging Het
Dock10 T C 1: 80,530,292 N1647S probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
Esyt1 T C 10: 128,516,369 E763G probably benign Het
Fbxo18 G T 2: 11,763,888 D332E possibly damaging Het
Fndc8 G A 11: 82,899,529 V275M probably damaging Het
Focad T G 4: 88,229,383 Y420D probably benign Het
Gml A T 15: 74,816,431 H62Q probably benign Het
Gpr158 A T 2: 21,827,318 L1076F probably benign Het
Gpr161 A G 1: 165,306,567 T133A possibly damaging Het
Gsg1l A T 7: 125,910,197 I256K possibly damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hnf1a G A 5: 114,960,195 A116V probably damaging Het
Hrh4 A T 18: 13,022,204 T267S probably damaging Het
Igfals A T 17: 24,880,304 N123I probably benign Het
Iglon5 T A 7: 43,479,121 T91S probably benign Het
Impg2 A T 16: 56,267,220 N1134I possibly damaging Het
Incenp A G 19: 9,872,729 V860A possibly damaging Het
Irf5 A T 6: 29,536,673 H461L possibly damaging Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kank2 A G 9: 21,795,465 S86P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnn3 A T 3: 89,520,994 M176L possibly damaging Het
Mccc1 A T 3: 35,985,001 I281N probably damaging Het
Mms19 G A 19: 41,953,677 A584V probably benign Het
Mon2 A T 10: 123,046,311 D184E probably damaging Het
Mrpl1 T C 5: 96,226,343 V159A possibly damaging Het
Myo18a C T 11: 77,818,771 T190I probably benign Het
Myo7a A T 7: 98,076,731 M1038K probably damaging Het
Myrfl T A 10: 116,832,947 I304F probably damaging Het
Neo1 G A 9: 58,917,031 R705* probably null Het
Nfat5 T C 8: 107,367,334 S736P probably benign Het
Nlrp4c C T 7: 6,065,766 P222L probably damaging Het
Nmt1 T A 11: 103,064,838 W481R probably damaging Het
Ntrk3 T A 7: 78,247,301 I663L probably damaging Het
Nup210l A T 3: 90,154,557 E681V probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr504 A T 7: 108,565,075 V240D probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pald1 ATGCTGCTGCTGCTGC ATGCTGCTGCTGC 10: 61,355,922 probably benign Het
Ppm1e T C 11: 87,231,695 T479A probably damaging Het
Ppp1r7 A G 1: 93,360,796 E298G probably benign Het
Prkaca T C 8: 83,990,987 probably null Het
Prss36 A G 7: 127,933,492 V718A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rrp12 G C 19: 41,880,481 D519E possibly damaging Het
Rufy4 T C 1: 74,134,120 L415P probably damaging Het
Ryk T A 9: 102,888,507 D335E probably benign Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Scin T C 12: 40,068,923 R625G possibly damaging Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Skiv2l2 C A 13: 112,913,099 probably null Het
Slc28a1 T C 7: 81,138,202 V279A possibly damaging Het
Slc30a8 T A 15: 52,331,557 probably null Het
Slco6d1 A G 1: 98,421,216 D4G probably damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Trpm1 G A 7: 64,235,007 R812H probably damaging Het
Tsga10 T A 1: 37,835,580 I75F probably damaging Het
Tyms C T 5: 30,062,016 probably null Het
Ubr4 A G 4: 139,425,697 probably null Het
Unc45a A G 7: 80,331,740 V438A possibly damaging Het
Usf2 T C 7: 30,955,340 D110G probably damaging Het
Vit T C 17: 78,546,446 probably null Het
Vmn2r104 A T 17: 20,042,235 M211K probably damaging Het
Vmn2r11 T C 5: 109,052,072 H505R probably benign Het
Vmn2r77 G A 7: 86,801,613 A236T probably damaging Het
Xpo1 T C 11: 23,285,155 M608T probably benign Het
Zfp112 T C 7: 24,124,960 F116L probably damaging Het
Zfp84 A G 7: 29,777,343 T487A possibly damaging Het
Zfpl1 A C 19: 6,081,871 L241R probably benign Het
Other mutations in Gpr83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gpr83 APN 9 14860601 missense probably benign 0.00
R0243:Gpr83 UTSW 9 14864842 missense possibly damaging 0.96
R0349:Gpr83 UTSW 9 14868267 missense probably damaging 1.00
R0731:Gpr83 UTSW 9 14868644 missense probably benign 0.00
R1519:Gpr83 UTSW 9 14868197 missense probably null 1.00
R1678:Gpr83 UTSW 9 14866849 missense probably damaging 1.00
R1826:Gpr83 UTSW 9 14868333 missense possibly damaging 0.53
R1828:Gpr83 UTSW 9 14868333 missense possibly damaging 0.53
R2938:Gpr83 UTSW 9 14864871 missense probably benign 0.23
R3760:Gpr83 UTSW 9 14860738 missense probably benign 0.03
R4038:Gpr83 UTSW 9 14860777 missense possibly damaging 0.77
R4438:Gpr83 UTSW 9 14864838 missense probably damaging 0.99
R4657:Gpr83 UTSW 9 14866983 critical splice donor site probably null
R4731:Gpr83 UTSW 9 14866174 intron probably benign
R5150:Gpr83 UTSW 9 14860805 missense probably damaging 1.00
R7770:Gpr83 UTSW 9 14866874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCTCAGTGAGGACATTG -3'
(R):5'- CTCATTGAGCCAGCAGTAGATG -3'

Sequencing Primer
(F):5'- CAGTGAGGACATTGTGCGCTC -3'
(R):5'- GGGTTATAACAAGTACTGCTCATGGC -3'
Posted On2014-06-23