Mutagenetix > Incidental Mutation

Incidental Mutation 'R1827:Nmt1'

206941

Institutional Source

Beutler Lab

Gene Symbol

Nmt1

Ensembl Gene

ENSMUSG00000020936

Gene Name

N-myristoyltransferase 1

Synonyms

MMRRC Submission

039854-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1827 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103028190-103068912 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103064838 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 481 (W481R)

Ref Sequence

ENSEMBL: ENSMUSP00000021314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021314]

AlphaFold

O70310

Predicted Effect

probably damaging
Transcript: ENSMUST00000021314
AA Change: W481R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021314
Gene: ENSMUSG00000020936
AA Change: W481R

Domain	Start	End	E-Value	Type
low complexity region	55	67	N/A	INTRINSIC
Pfam:NMT	137	294	6.7e-77	PFAM
Pfam:NMT_C	308	495	1.4e-85	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181125

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myristate, a rare 14-carbon saturated fatty acid, is cotranslationally attached by an amide linkage to the N-terminal glycine residue of cellular and viral proteins with diverse functions. N-myristoyltransferase (NMT; EC 2.3.1.97) catalyzes the transfer of myristate from CoA to proteins. N-myristoylation appears to be irreversible and is required for full expression of the biologic activities of several N-myristoylated proteins, including the alpha subunit of the signal-transducing guanine nucleotide-binding protein (G protein) GO (GNAO1; MIM 139311) (Duronio et al., 1992 [PubMed 1570339]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5 and E7.5. Heterozygotes show partial prenatal lethality. Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadsb	G	C	7: 131,441,275	R355T	probably damaging	Het
Ackr2	C	T	9: 121,909,515	R319C	probably benign	Het
Acot4	G	A	12: 84,041,938	A187T	probably damaging	Het
Adgrb2	A	C	4: 130,012,557	Q926P	probably damaging	Het
Adgrb3	T	C	1: 25,532,577	T420A	probably damaging	Het
Adra1b	A	T	11: 43,835,649	V147E	probably damaging	Het
Bco1	A	G	8: 117,105,759	Y98C	probably damaging	Het
C87977	G	A	4: 144,209,610	P27S	probably damaging	Het
Car5a	C	T	8: 121,923,808	V166M	probably benign	Het
Cdh5	T	C	8: 104,112,909	L4P	possibly damaging	Het
Clec12a	A	G	6: 129,353,799	T115A	probably damaging	Het
Cmya5	G	A	13: 93,074,448	T3279I	possibly damaging	Het
Col4a4	C	T	1: 82,539,988	G105D	unknown	Het
Cyp2d34	A	T	15: 82,616,094	H481Q	probably benign	Het
Dhx15	A	T	5: 52,170,080	C307*	probably null	Het
Dnah9	A	G	11: 65,850,061	Y4100H	probably damaging	Het
Dock10	T	C	1: 80,530,292	N1647S	probably benign	Het
Duox1	T	A	2: 122,347,380	Y1548*	probably null	Het
Esyt1	T	C	10: 128,516,369	E763G	probably benign	Het
Fbxo18	G	T	2: 11,763,888	D332E	possibly damaging	Het
Fndc8	G	A	11: 82,899,529	V275M	probably damaging	Het
Focad	T	G	4: 88,229,383	Y420D	probably benign	Het
Gml	A	T	15: 74,816,431	H62Q	probably benign	Het
Gpr158	A	T	2: 21,827,318	L1076F	probably benign	Het
Gpr161	A	G	1: 165,306,567	T133A	possibly damaging	Het
Gpr83	G	T	9: 14,868,333	C269F	possibly damaging	Het
Gsg1l	A	T	7: 125,910,197	I256K	possibly damaging	Het
Hao1	T	A	2: 134,530,664	R141S	probably benign	Het
Hnf1a	G	A	5: 114,960,195	A116V	probably damaging	Het
Hrh4	A	T	18: 13,022,204	T267S	probably damaging	Het
Igfals	A	T	17: 24,880,304	N123I	probably benign	Het
Iglon5	T	A	7: 43,479,121	T91S	probably benign	Het
Impg2	A	T	16: 56,267,220	N1134I	possibly damaging	Het
Incenp	A	G	19: 9,872,729	V860A	possibly damaging	Het
Irf5	A	T	6: 29,536,673	H461L	possibly damaging	Het
Itpr2	A	G	6: 146,328,332	L1255P	probably damaging	Het
Kank2	A	G	9: 21,795,465	S86P	probably damaging	Het
Kcnma1	C	A	14: 23,330,929	D903Y	probably damaging	Het
Kcnn3	A	T	3: 89,520,994	M176L	possibly damaging	Het
Mccc1	A	T	3: 35,985,001	I281N	probably damaging	Het
Mms19	G	A	19: 41,953,677	A584V	probably benign	Het
Mon2	A	T	10: 123,046,311	D184E	probably damaging	Het
Mrpl1	T	C	5: 96,226,343	V159A	possibly damaging	Het
Myo18a	C	T	11: 77,818,771	T190I	probably benign	Het
Myo7a	A	T	7: 98,076,731	M1038K	probably damaging	Het
Myrfl	T	A	10: 116,832,947	I304F	probably damaging	Het
Neo1	G	A	9: 58,917,031	R705*	probably null	Het
Nfat5	T	C	8: 107,367,334	S736P	probably benign	Het
Nlrp4c	C	T	7: 6,065,766	P222L	probably damaging	Het
Ntrk3	T	A	7: 78,247,301	I663L	probably damaging	Het
Nup210l	A	T	3: 90,154,557	E681V	probably damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr1202	A	T	2: 88,818,058	I296F	probably benign	Het
Olfr504	A	T	7: 108,565,075	V240D	probably benign	Het
Olfr543	A	G	7: 102,477,513	L119P	probably damaging	Het
Pald1	ATGCTGCTGCTGCTGC	ATGCTGCTGCTGC	10: 61,355,922		probably benign	Het
Ppm1e	T	C	11: 87,231,695	T479A	probably damaging	Het
Ppp1r7	A	G	1: 93,360,796	E298G	probably benign	Het
Prkaca	T	C	8: 83,990,987		probably null	Het
Prss36	A	G	7: 127,933,492	V718A	probably damaging	Het
Pxk	C	T	14: 8,151,507	R441*	probably null	Het
Rnf182	G	A	13: 43,668,534	W187*	probably null	Het
Rrp12	G	C	19: 41,880,481	D519E	possibly damaging	Het
Rufy4	T	C	1: 74,134,120	L415P	probably damaging	Het
Ryk	T	A	9: 102,888,507	D335E	probably benign	Het
S100a11	A	T	3: 93,526,121	I91F	probably benign	Het
Scin	T	C	12: 40,068,923	R625G	possibly damaging	Het
Simc1	T	A	13: 54,524,639	C267S	probably benign	Het
Skiv2l2	C	A	13: 112,913,099		probably null	Het
Slc28a1	T	C	7: 81,138,202	V279A	possibly damaging	Het
Slc30a8	T	A	15: 52,331,557		probably null	Het
Slco6d1	A	G	1: 98,421,216	D4G	probably damaging	Het
Tmem127	G	A	2: 127,256,174		probably null	Het
Trpm1	G	A	7: 64,235,007	R812H	probably damaging	Het
Tsga10	T	A	1: 37,835,580	I75F	probably damaging	Het
Tyms	C	T	5: 30,062,016		probably null	Het
Ubr4	A	G	4: 139,425,697		probably null	Het
Unc45a	A	G	7: 80,331,740	V438A	possibly damaging	Het
Usf2	T	C	7: 30,955,340	D110G	probably damaging	Het
Vit	T	C	17: 78,546,446		probably null	Het
Vmn2r104	A	T	17: 20,042,235	M211K	probably damaging	Het
Vmn2r11	T	C	5: 109,052,072	H505R	probably benign	Het
Vmn2r77	G	A	7: 86,801,613	A236T	probably damaging	Het
Xpo1	T	C	11: 23,285,155	M608T	probably benign	Het
Zfp112	T	C	7: 24,124,960	F116L	probably damaging	Het
Zfp84	A	G	7: 29,777,343	T487A	possibly damaging	Het
Zfpl1	A	C	19: 6,081,871	L241R	probably benign	Het

Other mutations in Nmt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Nmt1	APN	11	103060076	critical splice acceptor site	probably null
IGL02058:Nmt1	APN	11	103052290	missense	probably benign	0.00
IGL02582:Nmt1	APN	11	103064799	missense	possibly damaging	0.94
cropped	UTSW	11	103056459	missense	probably damaging	1.00
R0092:Nmt1	UTSW	11	103046493	missense	probably damaging	1.00
R1401:Nmt1	UTSW	11	103057481	missense	probably damaging	0.99
R1878:Nmt1	UTSW	11	103052251	missense	probably benign
R2199:Nmt1	UTSW	11	103063856	missense	probably damaging	1.00
R3930:Nmt1	UTSW	11	103052233	missense	probably benign	0.37
R4373:Nmt1	UTSW	11	103043200	missense	probably damaging	0.99
R4648:Nmt1	UTSW	11	103063917	missense	probably damaging	1.00
R5666:Nmt1	UTSW	11	103058215	nonsense	probably null
R6908:Nmt1	UTSW	11	103058254	missense	possibly damaging	0.92
R7315:Nmt1	UTSW	11	103060183	missense	probably benign
R7473:Nmt1	UTSW	11	103046400	missense	probably benign	0.05
R7504:Nmt1	UTSW	11	103056459	missense	probably damaging	1.00
R8548:Nmt1	UTSW	11	103043226	missense	possibly damaging	0.80
R8913:Nmt1	UTSW	11	103057445	missense	probably damaging	1.00
X0018:Nmt1	UTSW	11	103028586	missense	probably benign	0.01
Z1177:Nmt1	UTSW	11	103055213	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGAGCACTAACCAGGATGC -3'
(R):5'- ATTTCAAGGTACACAGTTAACCAGC -3'

Sequencing Primer
(F):5'- AACCTGTGATGGAAGCCTGC -3'
(R):5'- GTACACAGTTAACCAGCATAAGTG -3'

Posted On

2014-06-23