Incidental Mutation 'R0115:Frem2'
ID20703
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 038401-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0115 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53656208 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 293 (R293C)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably damaging
Transcript: ENSMUST00000091137
AA Change: R293C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: R293C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199323
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,594,142 probably benign Het
2310007B03Rik A T 1: 93,159,725 S135R possibly damaging Het
4921528I07Rik A G 9: 114,279,384 noncoding transcript Het
Alas1 A T 9: 106,238,252 probably null Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
Arhgap20 T A 9: 51,838,972 I344N probably damaging Het
Arhgap30 A C 1: 171,407,948 E630A possibly damaging Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bysl C T 17: 47,610,942 R77Q probably benign Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccdc146 T C 5: 21,322,756 I187M possibly damaging Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Ces5a A T 8: 93,502,183 M473K probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Cyp2c50 T A 19: 40,092,393 probably benign Het
Dlg1 C A 16: 31,805,690 Y399* probably null Het
Drosha A T 15: 12,846,130 E92D probably benign Het
Fanca C T 8: 123,268,539 G1408D probably benign Het
Frem1 T A 4: 82,936,169 D1621V possibly damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Glipr1 A G 10: 111,993,541 I105T probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Gm281 A G 14: 13,899,571 V117A probably damaging Het
Gon4l T A 3: 88,895,682 V1200D probably damaging Het
Gpc1 G A 1: 92,857,499 D387N probably damaging Het
Gsdmc A G 15: 63,803,637 Y110H probably damaging Het
Gucy1b1 T A 3: 82,034,391 H586L probably benign Het
Gucy2e A G 11: 69,236,632 L5P unknown Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hmcn1 T A 1: 150,808,647 I391F possibly damaging Het
Hsf4 A T 8: 105,272,704 probably null Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnma1 C A 14: 23,314,175 R980L probably damaging Het
Kif1a A G 1: 93,046,778 probably benign Het
Klhdc7b A G 15: 89,388,521 H1202R probably benign Het
Lig3 A G 11: 82,793,935 D559G probably damaging Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
March6 A T 15: 31,475,812 F633I probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Megf10 G T 18: 57,259,802 V424L possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mut C T 17: 40,956,227 T564M probably damaging Het
Myh8 A G 11: 67,306,264 probably benign Het
Mypn T C 10: 63,192,380 probably benign Het
Nf1 G A 11: 79,468,876 probably null Het
Notch3 T A 17: 32,133,462 T1866S possibly damaging Het
Olfr108 C T 17: 37,445,779 A86V probably benign Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr390 A G 11: 73,787,315 I126V possibly damaging Het
Pkhd1 A T 1: 20,350,490 I2464N probably damaging Het
Pkn1 A G 8: 83,671,029 S817P probably damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Psmd1 C T 1: 86,083,271 T356I possibly damaging Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rbm42 G A 7: 30,647,775 T106I probably damaging Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rorc T C 3: 94,377,609 probably benign Het
Rpl22l1 T C 3: 28,806,536 F15L probably damaging Het
Slc6a20a C A 9: 123,678,758 A17S possibly damaging Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Sp100 A G 1: 85,650,131 probably benign Het
Ssc5d G A 7: 4,927,881 probably benign Het
Taf11 A G 17: 27,907,661 L4P probably benign Het
Tm2d3 A G 7: 65,695,334 probably benign Het
Tmub2 T C 11: 102,288,375 probably null Het
Trim34a T A 7: 104,247,902 C58S probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r74 T C 7: 85,957,356 M261V probably benign Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Wdr95 A T 5: 149,564,390 D163V probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Ythdc2 C T 18: 44,841,423 probably benign Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
R7495:Frem2 UTSW 3 53516837 missense probably benign 0.13
R7542:Frem2 UTSW 3 53652579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATCTTCAGCAGGCGCAAATC -3'
(R):5'- AGACCCTTTTGATGGACTGCAAAGC -3'

Sequencing Primer
(F):5'- GCAAATCCCGCTGTGTAAAG -3'
(R):5'- TGATGGACTGCAAAGCATTCC -3'
Posted On2013-04-11