Incidental Mutation 'R0115:Frem2'
ID 20703
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene Name Fras1 related extracellular matrix protein 2
Synonyms 8430406N05Rik, ne, 6030440P17Rik, b2b1562Clo, my
MMRRC Submission 038401-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0115 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 3
Chromosomal Location 53421359-53564776 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 53563629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 293 (R293C)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000091137
AA Change: R293C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: R293C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199323
Meta Mutation Damage Score 0.3048 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,108,452 (GRCm39) noncoding transcript Het
Alas1 A T 9: 106,115,451 (GRCm39) probably null Het
Arf5 A G 6: 28,426,075 (GRCm39) Y154C probably damaging Het
Arhgap20 T A 9: 51,750,272 (GRCm39) I344N probably damaging Het
Arhgap30 A C 1: 171,235,516 (GRCm39) E630A possibly damaging Het
B4galt5 A G 2: 167,151,154 (GRCm39) L118P probably damaging Het
Bdp1 A G 13: 100,177,962 (GRCm39) I1969T probably benign Het
Bysl C T 17: 47,921,867 (GRCm39) R77Q probably benign Het
Cap1 A T 4: 122,756,868 (GRCm39) H272Q possibly damaging Het
Ccdc146 T C 5: 21,527,754 (GRCm39) I187M possibly damaging Het
Ccdc192 G A 18: 57,727,214 (GRCm39) probably benign Het
Cdhr18 A G 14: 13,899,571 (GRCm38) V117A probably damaging Het
Cdk13 C A 13: 17,894,079 (GRCm39) A1123S probably damaging Het
Ces5a A T 8: 94,228,811 (GRCm39) M473K probably damaging Het
Chd8 A G 14: 52,474,663 (GRCm39) S123P probably benign Het
Cwc22 G A 2: 77,738,455 (GRCm39) A497V probably damaging Het
Cwh43 T C 5: 73,575,370 (GRCm39) S296P probably damaging Het
Cyp2c50 T A 19: 40,080,837 (GRCm39) probably benign Het
Dlg1 C A 16: 31,624,508 (GRCm39) Y399* probably null Het
Drosha A T 15: 12,846,216 (GRCm39) E92D probably benign Het
Fanca C T 8: 123,995,278 (GRCm39) G1408D probably benign Het
Frem1 T A 4: 82,854,406 (GRCm39) D1621V possibly damaging Het
Fut8 T A 12: 77,495,334 (GRCm39) V308D probably damaging Het
Glipr1 A G 10: 111,829,446 (GRCm39) I105T probably benign Het
Glmn A T 5: 107,708,800 (GRCm39) S385T probably benign Het
Gon4l T A 3: 88,802,989 (GRCm39) V1200D probably damaging Het
Gpc1 G A 1: 92,785,221 (GRCm39) D387N probably damaging Het
Gsdmc A G 15: 63,675,486 (GRCm39) Y110H probably damaging Het
Gucy1b1 T A 3: 81,941,698 (GRCm39) H586L probably benign Het
Gucy2e A G 11: 69,127,458 (GRCm39) L5P unknown Het
Hectd4 A G 5: 121,433,569 (GRCm39) probably benign Het
Hmcn1 T A 1: 150,684,398 (GRCm39) I391F possibly damaging Het
Hsf4 A T 8: 105,999,336 (GRCm39) probably null Het
I830077J02Rik G A 3: 105,833,886 (GRCm39) T90M probably damaging Het
Ino80 A T 2: 119,261,497 (GRCm39) H722Q probably damaging Het
Kcnma1 C A 14: 23,364,243 (GRCm39) R980L probably damaging Het
Kif1a A G 1: 92,974,500 (GRCm39) probably benign Het
Klhdc7b A G 15: 89,272,724 (GRCm39) H1202R probably benign Het
Lig3 A G 11: 82,684,761 (GRCm39) D559G probably damaging Het
Lyst T C 13: 13,852,537 (GRCm39) V2179A probably benign Het
Mab21l4 A T 1: 93,087,447 (GRCm39) S135R possibly damaging Het
Mansc4 A G 6: 146,976,725 (GRCm39) I297T possibly damaging Het
Marchf6 A T 15: 31,475,958 (GRCm39) F633I probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Megf10 G T 18: 57,392,874 (GRCm39) V424L possibly damaging Het
Mfsd13a C T 19: 46,354,943 (GRCm39) T40I probably benign Het
Mib2 A G 4: 155,740,519 (GRCm39) probably benign Het
Mmut C T 17: 41,267,118 (GRCm39) T564M probably damaging Het
Myh8 A G 11: 67,197,090 (GRCm39) probably benign Het
Mypn T C 10: 63,028,159 (GRCm39) probably benign Het
Nf1 G A 11: 79,359,702 (GRCm39) probably null Het
Notch3 T A 17: 32,352,436 (GRCm39) T1866S possibly damaging Het
Or1e30 A G 11: 73,678,141 (GRCm39) I126V possibly damaging Het
Or1o11 C T 17: 37,756,670 (GRCm39) A86V probably benign Het
Or4c102 A T 2: 88,422,999 (GRCm39) I284F probably damaging Het
Or4k51 T A 2: 111,584,930 (GRCm39) M112K probably damaging Het
Pkhd1 A T 1: 20,420,714 (GRCm39) I2464N probably damaging Het
Pkn1 A G 8: 84,397,658 (GRCm39) S817P probably damaging Het
Prkg2 A T 5: 99,142,514 (GRCm39) probably null Het
Prl8a6 T C 13: 27,617,084 (GRCm39) D201G probably benign Het
Psmd1 C T 1: 86,010,993 (GRCm39) T356I possibly damaging Het
Ptk6 G A 2: 180,844,320 (GRCm39) probably benign Het
Ptprn2 T C 12: 117,175,466 (GRCm39) probably benign Het
Rbm42 G A 7: 30,347,200 (GRCm39) T106I probably damaging Het
Rims4 A T 2: 163,706,040 (GRCm39) V198E probably damaging Het
Ripk1 T C 13: 34,193,733 (GRCm39) S32P probably damaging Het
Rorc T C 3: 94,284,916 (GRCm39) probably benign Het
Rpl22l1 T C 3: 28,860,685 (GRCm39) F15L probably damaging Het
Slc6a20a C A 9: 123,507,823 (GRCm39) A17S possibly damaging Het
Sorcs1 A G 19: 50,624,891 (GRCm39) probably benign Het
Sp100 A G 1: 85,577,852 (GRCm39) probably benign Het
Ssc5d G A 7: 4,930,880 (GRCm39) probably benign Het
Taf11 A G 17: 28,126,635 (GRCm39) L4P probably benign Het
Tm2d3 A G 7: 65,345,082 (GRCm39) probably benign Het
Tmub2 T C 11: 102,179,201 (GRCm39) probably null Het
Trim34a T A 7: 103,897,109 (GRCm39) C58S probably damaging Het
Trpc3 T C 3: 36,678,566 (GRCm39) I840V probably benign Het
Trpm6 T C 19: 18,807,316 (GRCm39) V1020A probably damaging Het
Vmn1r214 T A 13: 23,219,464 (GRCm39) Y319* probably null Het
Vmn1r59 T C 7: 5,457,115 (GRCm39) N215S probably benign Het
Vmn2r74 T C 7: 85,606,564 (GRCm39) M261V probably benign Het
Vmn2r89 T C 14: 51,693,577 (GRCm39) F309S probably damaging Het
Wdr95 A T 5: 149,487,855 (GRCm39) D163V probably damaging Het
Xirp2 T A 2: 67,340,253 (GRCm39) F831L possibly damaging Het
Ythdc2 C T 18: 44,974,490 (GRCm39) probably benign Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53,493,016 (GRCm39) missense probably damaging 1.00
IGL00911:Frem2 APN 3 53,479,883 (GRCm39) missense probably damaging 1.00
IGL01322:Frem2 APN 3 53,448,459 (GRCm39) missense probably benign 0.00
IGL01330:Frem2 APN 3 53,562,662 (GRCm39) missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53,433,317 (GRCm39) missense probably damaging 1.00
IGL01556:Frem2 APN 3 53,442,702 (GRCm39) missense probably benign 0.23
IGL01580:Frem2 APN 3 53,562,596 (GRCm39) missense probably damaging 1.00
IGL01606:Frem2 APN 3 53,561,012 (GRCm39) missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53,563,130 (GRCm39) missense probably benign 0.00
IGL01648:Frem2 APN 3 53,443,153 (GRCm39) missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53,424,434 (GRCm39) missense probably damaging 1.00
IGL01665:Frem2 APN 3 53,457,083 (GRCm39) missense probably benign 0.07
IGL01670:Frem2 APN 3 53,564,358 (GRCm39) missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53,429,725 (GRCm39) missense probably benign 0.33
IGL02175:Frem2 APN 3 53,563,020 (GRCm39) missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53,427,061 (GRCm39) missense probably benign 0.35
IGL02202:Frem2 APN 3 53,562,220 (GRCm39) missense probably benign 0.00
IGL02427:Frem2 APN 3 53,443,184 (GRCm39) missense probably damaging 0.97
IGL02457:Frem2 APN 3 53,428,470 (GRCm39) missense probably damaging 0.99
IGL02638:Frem2 APN 3 53,458,767 (GRCm39) missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53,559,596 (GRCm39) missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53,563,049 (GRCm39) missense probably benign 0.40
IGL03169:Frem2 APN 3 53,429,713 (GRCm39) missense probably benign 0.01
IGL03238:Frem2 APN 3 53,563,682 (GRCm39) missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53,479,729 (GRCm39) missense probably benign 0.01
IGL03273:Frem2 APN 3 53,444,930 (GRCm39) nonsense probably null
IGL03343:Frem2 APN 3 53,559,674 (GRCm39) missense probably damaging 1.00
Biosimilar UTSW 3 53,561,744 (GRCm39) missense probably benign 0.01
Fruit_stripe UTSW 3 53,444,910 (GRCm39) missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53,560,622 (GRCm39) missense probably damaging 0.98
R0019:Frem2 UTSW 3 53,431,099 (GRCm39) missense probably damaging 0.99
R0092:Frem2 UTSW 3 53,497,217 (GRCm39) missense probably benign 0.03
R0108:Frem2 UTSW 3 53,555,382 (GRCm39) missense probably benign 0.03
R0118:Frem2 UTSW 3 53,442,664 (GRCm39) nonsense probably null
R0374:Frem2 UTSW 3 53,561,381 (GRCm39) missense probably damaging 1.00
R0437:Frem2 UTSW 3 53,560,436 (GRCm39) missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53,427,375 (GRCm39) missense probably damaging 1.00
R0555:Frem2 UTSW 3 53,424,281 (GRCm39) missense probably damaging 0.97
R0564:Frem2 UTSW 3 53,563,530 (GRCm39) missense probably damaging 0.97
R0586:Frem2 UTSW 3 53,555,342 (GRCm39) missense probably damaging 0.99
R0726:Frem2 UTSW 3 53,427,047 (GRCm39) missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53,561,394 (GRCm39) missense probably benign
R1233:Frem2 UTSW 3 53,455,199 (GRCm39) missense probably damaging 0.98
R1302:Frem2 UTSW 3 53,562,959 (GRCm39) missense probably benign 0.00
R1333:Frem2 UTSW 3 53,457,152 (GRCm39) missense probably benign 0.26
R1446:Frem2 UTSW 3 53,562,017 (GRCm39) missense probably benign 0.31
R1523:Frem2 UTSW 3 53,562,828 (GRCm39) missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53,561,631 (GRCm39) missense probably benign 0.19
R1543:Frem2 UTSW 3 53,479,876 (GRCm39) missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53,561,940 (GRCm39) missense probably benign 0.19
R1600:Frem2 UTSW 3 53,455,144 (GRCm39) missense probably damaging 1.00
R1678:Frem2 UTSW 3 53,427,359 (GRCm39) missense probably damaging 1.00
R1687:Frem2 UTSW 3 53,561,373 (GRCm39) missense probably benign
R1696:Frem2 UTSW 3 53,563,463 (GRCm39) nonsense probably null
R1758:Frem2 UTSW 3 53,560,778 (GRCm39) missense probably damaging 1.00
R1857:Frem2 UTSW 3 53,562,294 (GRCm39) missense probably benign 0.10
R1869:Frem2 UTSW 3 53,442,617 (GRCm39) missense probably benign 0.04
R1921:Frem2 UTSW 3 53,560,916 (GRCm39) missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53,559,653 (GRCm39) missense probably benign 0.01
R2045:Frem2 UTSW 3 53,443,165 (GRCm39) missense probably damaging 1.00
R2113:Frem2 UTSW 3 53,560,343 (GRCm39) missense probably damaging 1.00
R2152:Frem2 UTSW 3 53,424,450 (GRCm39) nonsense probably null
R2164:Frem2 UTSW 3 53,444,751 (GRCm39) missense probably damaging 1.00
R2181:Frem2 UTSW 3 53,482,008 (GRCm39) missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53,423,994 (GRCm39) missense probably benign
R2221:Frem2 UTSW 3 53,424,278 (GRCm39) missense probably benign 0.00
R2255:Frem2 UTSW 3 53,559,935 (GRCm39) missense probably damaging 0.96
R2280:Frem2 UTSW 3 53,479,844 (GRCm39) missense probably damaging 1.00
R3196:Frem2 UTSW 3 53,444,752 (GRCm39) missense probably damaging 1.00
R3716:Frem2 UTSW 3 53,479,781 (GRCm39) missense probably damaging 1.00
R3807:Frem2 UTSW 3 53,560,870 (GRCm39) missense probably benign 0.22
R3820:Frem2 UTSW 3 53,424,270 (GRCm39) missense probably damaging 1.00
R3821:Frem2 UTSW 3 53,559,836 (GRCm39) missense probably damaging 1.00
R3977:Frem2 UTSW 3 53,559,491 (GRCm39) missense probably benign 0.00
R3979:Frem2 UTSW 3 53,559,491 (GRCm39) missense probably benign 0.00
R4014:Frem2 UTSW 3 53,559,774 (GRCm39) missense probably benign 0.01
R4127:Frem2 UTSW 3 53,433,317 (GRCm39) missense probably damaging 1.00
R4195:Frem2 UTSW 3 53,446,689 (GRCm39) missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53,446,689 (GRCm39) missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53,452,923 (GRCm39) missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53,446,583 (GRCm39) critical splice donor site probably null
R4428:Frem2 UTSW 3 53,561,759 (GRCm39) missense probably benign 0.40
R4559:Frem2 UTSW 3 53,561,742 (GRCm39) missense probably benign 0.01
R4600:Frem2 UTSW 3 53,455,228 (GRCm39) missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53,455,228 (GRCm39) missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53,455,228 (GRCm39) missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53,455,228 (GRCm39) missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53,562,864 (GRCm39) missense probably damaging 1.00
R4678:Frem2 UTSW 3 53,451,792 (GRCm39) missense probably benign 0.00
R4689:Frem2 UTSW 3 53,455,056 (GRCm39) missense probably benign 0.43
R4740:Frem2 UTSW 3 53,443,240 (GRCm39) missense probably benign 0.04
R4748:Frem2 UTSW 3 53,448,514 (GRCm39) missense probably damaging 1.00
R4790:Frem2 UTSW 3 53,424,162 (GRCm39) missense probably benign
R4809:Frem2 UTSW 3 53,561,316 (GRCm39) missense probably benign 0.01
R4930:Frem2 UTSW 3 53,563,736 (GRCm39) missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53,446,604 (GRCm39) missense probably damaging 1.00
R5057:Frem2 UTSW 3 53,442,617 (GRCm39) missense probably benign 0.37
R5202:Frem2 UTSW 3 53,458,767 (GRCm39) missense probably benign 0.41
R5221:Frem2 UTSW 3 53,493,032 (GRCm39) missense probably damaging 1.00
R5231:Frem2 UTSW 3 53,429,716 (GRCm39) missense probably damaging 1.00
R5268:Frem2 UTSW 3 53,560,575 (GRCm39) missense probably damaging 0.96
R5480:Frem2 UTSW 3 53,563,928 (GRCm39) nonsense probably null
R5637:Frem2 UTSW 3 53,560,358 (GRCm39) missense probably damaging 0.97
R5664:Frem2 UTSW 3 53,559,911 (GRCm39) missense probably benign 0.33
R5698:Frem2 UTSW 3 53,559,926 (GRCm39) missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53,563,380 (GRCm39) missense probably damaging 1.00
R5754:Frem2 UTSW 3 53,444,679 (GRCm39) missense probably damaging 1.00
R5808:Frem2 UTSW 3 53,559,984 (GRCm39) missense probably damaging 0.96
R5840:Frem2 UTSW 3 53,555,342 (GRCm39) missense probably damaging 0.99
R5874:Frem2 UTSW 3 53,444,910 (GRCm39) missense probably benign 0.21
R6050:Frem2 UTSW 3 53,560,433 (GRCm39) missense probably damaging 0.99
R6103:Frem2 UTSW 3 53,457,209 (GRCm39) missense probably benign 0.00
R6149:Frem2 UTSW 3 53,458,762 (GRCm39) missense probably damaging 0.98
R6182:Frem2 UTSW 3 53,555,390 (GRCm39) missense probably damaging 1.00
R6191:Frem2 UTSW 3 53,562,701 (GRCm39) missense probably benign 0.10
R6245:Frem2 UTSW 3 53,563,245 (GRCm39) missense probably benign 0.00
R6252:Frem2 UTSW 3 53,479,869 (GRCm39) missense probably damaging 1.00
R6393:Frem2 UTSW 3 53,493,061 (GRCm39) missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53,479,799 (GRCm39) missense probably benign 0.01
R6595:Frem2 UTSW 3 53,457,205 (GRCm39) missense probably damaging 1.00
R6665:Frem2 UTSW 3 53,562,077 (GRCm39) missense probably damaging 1.00
R6708:Frem2 UTSW 3 53,492,922 (GRCm39) missense probably benign 0.00
R6751:Frem2 UTSW 3 53,561,086 (GRCm39) missense probably damaging 1.00
R6787:Frem2 UTSW 3 53,561,744 (GRCm39) missense probably benign 0.01
R6913:Frem2 UTSW 3 53,424,242 (GRCm39) missense probably damaging 1.00
R6916:Frem2 UTSW 3 53,455,109 (GRCm39) missense probably damaging 1.00
R7017:Frem2 UTSW 3 53,427,023 (GRCm39) missense probably benign 0.02
R7083:Frem2 UTSW 3 53,444,914 (GRCm39) missense probably damaging 0.99
R7108:Frem2 UTSW 3 53,560,934 (GRCm39) missense probably damaging 1.00
R7133:Frem2 UTSW 3 53,479,760 (GRCm39) missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53,562,174 (GRCm39) missense probably damaging 1.00
R7341:Frem2 UTSW 3 53,561,916 (GRCm39) missense probably damaging 1.00
R7455:Frem2 UTSW 3 53,479,701 (GRCm39) splice site probably null
R7487:Frem2 UTSW 3 53,561,970 (GRCm39) missense probably benign 0.40
R7495:Frem2 UTSW 3 53,424,258 (GRCm39) missense probably benign 0.13
R7542:Frem2 UTSW 3 53,560,000 (GRCm39) missense probably damaging 1.00
R7636:Frem2 UTSW 3 53,560,668 (GRCm39) missense probably benign 0.00
R7703:Frem2 UTSW 3 53,429,589 (GRCm39) missense probably benign 0.01
R7750:Frem2 UTSW 3 53,431,103 (GRCm39) missense possibly damaging 0.83
R7849:Frem2 UTSW 3 53,479,795 (GRCm39) missense probably damaging 1.00
R7922:Frem2 UTSW 3 53,560,725 (GRCm39) missense probably damaging 0.98
R8008:Frem2 UTSW 3 53,560,331 (GRCm39) missense probably damaging 1.00
R8051:Frem2 UTSW 3 53,442,776 (GRCm39) missense probably benign 0.04
R8052:Frem2 UTSW 3 53,457,064 (GRCm39) missense probably benign 0.02
R8176:Frem2 UTSW 3 53,562,761 (GRCm39) missense possibly damaging 0.50
R8220:Frem2 UTSW 3 53,563,928 (GRCm39) nonsense probably null
R8397:Frem2 UTSW 3 53,560,562 (GRCm39) missense probably benign 0.00
R8410:Frem2 UTSW 3 53,446,598 (GRCm39) missense possibly damaging 0.60
R8697:Frem2 UTSW 3 53,433,249 (GRCm39) missense probably damaging 0.99
R9134:Frem2 UTSW 3 53,562,321 (GRCm39) missense probably damaging 1.00
R9183:Frem2 UTSW 3 53,427,486 (GRCm39) missense probably damaging 1.00
R9260:Frem2 UTSW 3 53,560,204 (GRCm39) missense probably damaging 1.00
R9267:Frem2 UTSW 3 53,564,504 (GRCm39) start codon destroyed probably null 0.00
R9299:Frem2 UTSW 3 53,563,980 (GRCm39) missense probably benign 0.37
R9378:Frem2 UTSW 3 53,559,410 (GRCm39) missense probably damaging 0.99
R9444:Frem2 UTSW 3 53,560,265 (GRCm39) missense probably benign 0.10
R9459:Frem2 UTSW 3 53,560,907 (GRCm39) missense probably benign
R9487:Frem2 UTSW 3 53,560,905 (GRCm39) missense possibly damaging 0.95
R9728:Frem2 UTSW 3 53,564,052 (GRCm39) missense probably benign 0.00
R9759:Frem2 UTSW 3 53,562,918 (GRCm39) missense possibly damaging 0.76
Z1177:Frem2 UTSW 3 53,563,028 (GRCm39) missense probably benign 0.31
Z1177:Frem2 UTSW 3 53,442,587 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCAATCTTCAGCAGGCGCAAATC -3'
(R):5'- AGACCCTTTTGATGGACTGCAAAGC -3'

Sequencing Primer
(F):5'- GCAAATCCCGCTGTGTAAAG -3'
(R):5'- TGATGGACTGCAAAGCATTCC -3'
Posted On 2013-04-11