Mutagenetix > Incidental Mutation

Incidental Mutation 'R1829:Zbtb41'

207064

Institutional Source

Beutler Lab

Gene Symbol

Zbtb41

Ensembl Gene

ENSMUSG00000033964

Gene Name

zinc finger and BTB domain containing 41

Synonyms

9830132G07Rik, 8430415N23Rik

MMRRC Submission

039856-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.149) question?

Stock #

R1829 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139422288-139453005 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 139446922 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 707 (K707*)

Ref Sequence

ENSEMBL: ENSMUSP00000045570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039867]

AlphaFold

Q811F1

Predicted Effect

probably null
Transcript: ENSMUST00000039867
AA Change: K707*

SMART Domains

Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964
AA Change: K707*

Domain	Start	End	E-Value	Type
low complexity region	70	81	N/A	INTRINSIC
BTB	89	183	7.06e-16	SMART
ZnF_C2H2	208	231	3.78e-1	SMART
low complexity region	234	245	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	301	327	N/A	INTRINSIC
ZnF_C2H2	360	382	4.17e-3	SMART
ZnF_C2H2	388	410	8.34e-3	SMART
ZnF_C2H2	421	444	2.67e-1	SMART
ZnF_C2H2	462	484	1.72e-4	SMART
ZnF_C2H2	490	513	1.41e0	SMART
ZnF_C2H2	517	540	1.12e-3	SMART
ZnF_C2H2	546	568	1.36e-2	SMART
ZnF_C2H2	574	596	2.91e-2	SMART
ZnF_C2H2	602	624	7.37e-4	SMART
ZnF_C2H2	630	653	3.39e-3	SMART
ZnF_C2H2	667	689	2.75e-3	SMART
ZnF_C2H2	695	717	3.16e-3	SMART
ZnF_C2H2	723	746	3.34e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199011

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7420426K07Rik	T	A	9: 98,903,393	I37N	possibly damaging	Het
Aars	A	T	8: 111,042,706	D287V	probably damaging	Het
Abca12	A	G	1: 71,295,029	C1105R	probably benign	Het
Abca8b	T	A	11: 109,942,341	N1178Y	probably damaging	Het
Abhd12	A	G	2: 150,843,398	L189P	probably damaging	Het
Acap2	G	T	16: 31,110,934	N435K	probably damaging	Het
Adam6b	G	T	12: 113,489,925	G121C	probably damaging	Het
Adgrb1	C	A	15: 74,580,586	C200*	probably null	Het
Agbl5	T	C	5: 30,903,064	S730P	possibly damaging	Het
Ahsg	G	A	16: 22,892,328		probably benign	Het
Aldh9a1	A	T	1: 167,361,854	K390N	probably benign	Het
Alpk2	T	A	18: 65,294,094	H1857L	possibly damaging	Het
Apip	T	A	2: 103,088,662	N102K	probably benign	Het
Asxl2	T	C	12: 3,457,125	S106P	probably damaging	Het
Atp2b2	G	T	6: 113,773,368	R677S	probably damaging	Het
Barhl1	A	C	2: 28,909,845	M256R	probably damaging	Het
BC025446	T	G	15: 75,216,756		probably null	Het
BC052040	G	T	2: 115,642,692	R101L	possibly damaging	Het
Cacnb2	A	T	2: 14,985,964	Q619L	possibly damaging	Het
Ccdc137	C	T	11: 120,458,212	P23L	probably benign	Het
Cdh11	A	T	8: 102,634,641	N688K	possibly damaging	Het
Cdh18	C	T	15: 23,173,852	P51S	probably damaging	Het
Cfhr1	A	T	1: 139,553,600	Y181N	probably damaging	Het
Chmp3	A	G	6: 71,560,939	D50G	probably benign	Het
Crem	T	C	18: 3,295,037		probably null	Het
Cyb561a3	G	A	19: 10,582,393	W27*	probably null	Het
Cyp2d12	C	A	15: 82,558,056	N297K	possibly damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	T	C	14: 26,773,023	L1346P	probably damaging	Het
Dnah12	T	A	14: 26,800,075	N1948K	probably damaging	Het
Dsp	T	G	13: 38,193,195	L1652R	probably damaging	Het
Dstyk	G	A	1: 132,449,595	S66N	probably benign	Het
Ehhadh	T	C	16: 21,762,178	E688G	probably damaging	Het
Emsy	T	A	7: 98,602,729	H688L	possibly damaging	Het
Emsy	G	T	7: 98,602,730	H688N	possibly damaging	Het
Endod1	A	G	9: 14,356,926	L421P	probably damaging	Het
Fam222b	C	T	11: 78,155,035	P346L	probably damaging	Het
Fam3c	G	A	6: 22,309,437	R182W	probably damaging	Het
Gck	T	C	11: 5,910,984	D29G	probably damaging	Het
Gm10320	C	A	13: 98,489,699	R59L	probably damaging	Het
Gm11127	G	T	17: 36,058,004	F61L	probably damaging	Het
Gm21798	C	T	15: 64,817,826		probably benign	Het
Gm9376	A	G	14: 118,267,545	T130A	possibly damaging	Het
Gpr153	T	A	4: 152,282,392	I334N	possibly damaging	Het
Greb1l	T	C	18: 10,509,314	L542P	probably damaging	Het
Hacl1	T	C	14: 31,640,534	E52G	probably benign	Het
Ice2	A	G	9: 69,407,353	Y128C	probably damaging	Het
Ikzf2	T	A	1: 69,542,287	I121L	probably benign	Het
Ipcef1	C	T	10: 6,919,900	A167T	probably benign	Het
Jakmip2	T	A	18: 43,582,080	D127V	possibly damaging	Het
Jph4	T	C	14: 55,114,911	T122A	probably damaging	Het
Kcns2	A	G	15: 34,838,803	E104G	probably damaging	Het
Lars2	A	C	9: 123,431,917	R384S	probably benign	Het
Lsmem1	T	A	12: 40,185,408	H3L	possibly damaging	Het
Lsmem1	G	T	12: 40,185,409	H3N	possibly damaging	Het
Mfhas1	A	C	8: 35,590,068	S566R	probably benign	Het
Mfhas1	C	G	8: 35,590,248	R626G	probably benign	Het
Mgam	A	G	6: 40,666,892	T585A	probably damaging	Het
Mmp25	T	C	17: 23,640,023	K185E	probably benign	Het
Mtch1	T	C	17: 29,338,776	I243V	probably damaging	Het
Mtcp1	A	T	X: 75,411,665	Y25*	probably null	Het
Mybl2	A	G	2: 163,059,583	T35A	probably benign	Het
Myh11	T	C	16: 14,223,880	E736G	probably damaging	Het
Myh2	T	C	11: 67,176,559	I224T	probably damaging	Het
Mymx	T	C	17: 45,601,833		probably benign	Het
Nek10	A	G	14: 14,863,454		probably null	Het
Nsd1	A	T	13: 55,246,369	K697N	probably damaging	Het
Nynrin	A	G	14: 55,872,947	D1837G	possibly damaging	Het
Olfr115	G	A	17: 37,610,277	T158I	probably benign	Het
Olfr424	T	A	1: 174,137,194	I150N	probably benign	Het
Olfr510	T	A	7: 108,667,644	I76N	probably benign	Het
Olfr593	A	T	7: 103,211,886	T9S	probably benign	Het
Olfr701	A	G	7: 106,819,007	H308R	probably benign	Het
Phf19	T	C	2: 34,911,769	T10A	probably benign	Het
Pkd1	A	T	17: 24,565,584	H368L	probably benign	Het
Plscr2	A	G	9: 92,290,755	R156G	probably damaging	Het
Ppp1r42	G	A	1: 10,000,086	R61C	probably benign	Het
Pptc7	T	G	5: 122,313,616	V45G	probably damaging	Het
Prlhr	G	A	19: 60,467,429	T233I	probably damaging	Het
Reps1	C	T	10: 18,107,714	T435I	probably damaging	Het
Ret	T	A	6: 118,153,951	T1084S	probably damaging	Het
Rgl2	T	A	17: 33,933,621	M402K	probably benign	Het
Rp2	A	G	X: 20,376,915	K43R	probably benign	Het
Rundc3b	A	T	5: 8,579,117	W95R	probably damaging	Het
Samd9l	T	C	6: 3,375,107	D718G	possibly damaging	Het
Scnn1b	G	A	7: 121,902,845	R242H	probably benign	Het
Smad4	G	T	18: 73,641,894	Q445K	probably benign	Het
Smchd1	G	T	17: 71,370,337	P1486T	probably damaging	Het
Snx25	G	T	8: 46,035,632	N895K	possibly damaging	Het
Sox2	A	G	3: 34,650,741	D109G	probably damaging	Het
Stfa2	A	T	16: 36,405,202	N38K	probably damaging	Het
Stfa2	C	A	16: 36,405,211	E35D	possibly damaging	Het
Stfa3	A	G	16: 36,450,661	L87P	probably damaging	Het
Strbp	T	C	2: 37,640,909	D111G	possibly damaging	Het
Supt20	C	A	3: 54,727,658		probably benign	Het
Svep1	A	G	4: 58,096,310	Y1437H	possibly damaging	Het
Tbx4	T	A	11: 85,911,920		probably null	Het
Tmem117	A	T	15: 95,094,551	N364I	probably damaging	Het
Tmem8	T	C	17: 26,122,220	Y766H	probably damaging	Het
Trat1	T	C	16: 48,761,379	E45G	probably damaging	Het
Trpc2	G	A	7: 102,084,119	D92N	probably damaging	Het
Trpm1	G	A	7: 64,226,782	D528N	probably damaging	Het
Ttll9	A	G	2: 153,000,236	S337G	possibly damaging	Het
Utrn	A	T	10: 12,475,274	I355N	probably damaging	Het
Vangl1	A	G	3: 102,163,466	S385P	probably benign	Het
Vmn1r209	A	G	13: 22,806,239	S94P	possibly damaging	Het
Vmn2r28	T	A	7: 5,493,811	Q14L	probably benign	Het
Vps45	A	G	3: 96,047,245		probably null	Het
Wdr48	T	C	9: 119,904,330	V81A	probably benign	Het
Xpnpep2	A	G	X: 48,125,353	N476S	probably benign	Het
Zfp442	A	C	2: 150,409,063	C306W	probably damaging	Het
Zfp811	T	C	17: 32,798,142	N307S	possibly damaging	Het
Zfp976	A	G	7: 42,616,311	W17R	probably damaging	Het
Zyg11b	T	C	4: 108,266,093	T226A	possibly damaging	Het

Other mutations in Zbtb41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Zbtb41	APN	1	139430324	missense	probably benign	0.01
IGL01796:Zbtb41	APN	1	139442883	missense	probably damaging	0.99
IGL01844:Zbtb41	APN	1	139447327	missense	probably benign	0.01
IGL02150:Zbtb41	APN	1	139440448	missense	possibly damaging	0.73
IGL02346:Zbtb41	APN	1	139447100	missense	probably damaging	1.00
IGL03139:Zbtb41	APN	1	139423838	missense	probably benign	0.00
IGL03215:Zbtb41	APN	1	139446950	missense	probably damaging	1.00
IGL03309:Zbtb41	APN	1	139432078	critical splice donor site	probably null
memorialized	UTSW	1	139440394	missense	probably benign	0.00
Noted	UTSW	1	139439031	missense	probably damaging	0.99
R7584_zbtb41_939	UTSW	1	139424057	missense	probably benign	0.14
unforgotten	UTSW	1	139432078	critical splice donor site	probably null
R0004:Zbtb41	UTSW	1	139442888	missense	possibly damaging	0.90
R0010:Zbtb41	UTSW	1	139423530	missense	probably damaging	1.00
R0010:Zbtb41	UTSW	1	139423530	missense	probably damaging	1.00
R0048:Zbtb41	UTSW	1	139441834	missense	probably damaging	1.00
R0230:Zbtb41	UTSW	1	139446935	missense	probably damaging	1.00
R0309:Zbtb41	UTSW	1	139438984	missense	probably damaging	0.99
R0458:Zbtb41	UTSW	1	139423476	missense	probably damaging	1.00
R0606:Zbtb41	UTSW	1	139423610	missense	probably benign	0.28
R0964:Zbtb41	UTSW	1	139439031	missense	probably damaging	0.99
R1531:Zbtb41	UTSW	1	139423193	missense	probably benign	0.00
R1723:Zbtb41	UTSW	1	139423563	missense	probably benign	0.39
R1765:Zbtb41	UTSW	1	139440394	missense	probably benign	0.00
R2077:Zbtb41	UTSW	1	139424093	missense	probably damaging	1.00
R2292:Zbtb41	UTSW	1	139440359	missense	probably damaging	0.99
R2380:Zbtb41	UTSW	1	139423814	missense	probably damaging	0.99
R2402:Zbtb41	UTSW	1	139423185	missense	probably benign	0.10
R2402:Zbtb41	UTSW	1	139423187	nonsense	probably null
R3847:Zbtb41	UTSW	1	139423996	missense	probably benign
R3848:Zbtb41	UTSW	1	139423996	missense	probably benign
R3849:Zbtb41	UTSW	1	139423996	missense	probably benign
R4077:Zbtb41	UTSW	1	139429326	missense	probably benign	0.11
R4641:Zbtb41	UTSW	1	139442819	missense	probably damaging	0.98
R4772:Zbtb41	UTSW	1	139447414	missense	probably damaging	1.00
R5646:Zbtb41	UTSW	1	139423763	missense	probably benign	0.05
R5754:Zbtb41	UTSW	1	139432078	critical splice donor site	probably null
R6002:Zbtb41	UTSW	1	139423659	missense	probably damaging	1.00
R6045:Zbtb41	UTSW	1	139424032	missense	probably benign	0.34
R6302:Zbtb41	UTSW	1	139429289	missense	possibly damaging	0.67
R6318:Zbtb41	UTSW	1	139430306	missense	possibly damaging	0.91
R6430:Zbtb41	UTSW	1	139447207	missense	probably benign	0.02
R6906:Zbtb41	UTSW	1	139423390	missense	possibly damaging	0.59
R7584:Zbtb41	UTSW	1	139424057	missense	probably benign	0.14
R7753:Zbtb41	UTSW	1	139447157	missense	probably benign
R8132:Zbtb41	UTSW	1	139423217	missense	probably benign	0.00
R8138:Zbtb41	UTSW	1	139441807	missense	probably damaging	1.00
R8205:Zbtb41	UTSW	1	139429181	missense	possibly damaging	0.96
R8823:Zbtb41	UTSW	1	139423154	missense	probably damaging	1.00
R8967:Zbtb41	UTSW	1	139442849	missense	probably benign
R9431:Zbtb41	UTSW	1	139423043	start gained	probably benign
R9500:Zbtb41	UTSW	1	139432068	missense	probably damaging	1.00
R9559:Zbtb41	UTSW	1	139430315	missense	probably benign	0.14
R9603:Zbtb41	UTSW	1	139447517	missense	probably damaging	1.00
R9789:Zbtb41	UTSW	1	139440346	missense	probably damaging	1.00
Z1177:Zbtb41	UTSW	1	139423416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGAAGCCCAGATCATTTTGATG -3'
(R):5'- AGTACTCCATTGGCAAAGACATG -3'

Sequencing Primer
(F):5'- CCAGCTTATCAAGTGGGT -3'
(R):5'- GGCAAAGACATGAGTTTTTCCTCAG -3'

Posted On

2014-06-23