Mutagenetix > Incidental Mutation

Incidental Mutation 'R1829:Trpm1'

207105

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

039856-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1829 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64226782 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 528 (D528N)

Ref Sequence

ENSEMBL: ENSMUSP00000146140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

probably damaging
Transcript: ENSMUST00000085222
AA Change: D644N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: D644N

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000107525
AA Change: D644N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: D644N

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177102

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205939

Predicted Effect

probably benign
Transcript: ENSMUST00000205994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

probably damaging
Transcript: ENSMUST00000206263
AA Change: D528N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: D644N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206740

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7420426K07Rik	T	A	9: 98,903,393	I37N	possibly damaging	Het
Aars	A	T	8: 111,042,706	D287V	probably damaging	Het
Abca12	A	G	1: 71,295,029	C1105R	probably benign	Het
Abca8b	T	A	11: 109,942,341	N1178Y	probably damaging	Het
Abhd12	A	G	2: 150,843,398	L189P	probably damaging	Het
Acap2	G	T	16: 31,110,934	N435K	probably damaging	Het
Adam6b	G	T	12: 113,489,925	G121C	probably damaging	Het
Adgrb1	C	A	15: 74,580,586	C200*	probably null	Het
Agbl5	T	C	5: 30,903,064	S730P	possibly damaging	Het
Ahsg	G	A	16: 22,892,328		probably benign	Het
Aldh9a1	A	T	1: 167,361,854	K390N	probably benign	Het
Alpk2	T	A	18: 65,294,094	H1857L	possibly damaging	Het
Apip	T	A	2: 103,088,662	N102K	probably benign	Het
Asxl2	T	C	12: 3,457,125	S106P	probably damaging	Het
Atp2b2	G	T	6: 113,773,368	R677S	probably damaging	Het
Barhl1	A	C	2: 28,909,845	M256R	probably damaging	Het
BC025446	T	G	15: 75,216,756		probably null	Het
BC052040	G	T	2: 115,642,692	R101L	possibly damaging	Het
Cacnb2	A	T	2: 14,985,964	Q619L	possibly damaging	Het
Ccdc137	C	T	11: 120,458,212	P23L	probably benign	Het
Cdh11	A	T	8: 102,634,641	N688K	possibly damaging	Het
Cdh18	C	T	15: 23,173,852	P51S	probably damaging	Het
Cfhr1	A	T	1: 139,553,600	Y181N	probably damaging	Het
Chmp3	A	G	6: 71,560,939	D50G	probably benign	Het
Crem	T	C	18: 3,295,037		probably null	Het
Cyb561a3	G	A	19: 10,582,393	W27*	probably null	Het
Cyp2d12	C	A	15: 82,558,056	N297K	possibly damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	T	C	14: 26,773,023	L1346P	probably damaging	Het
Dnah12	T	A	14: 26,800,075	N1948K	probably damaging	Het
Dsp	T	G	13: 38,193,195	L1652R	probably damaging	Het
Dstyk	G	A	1: 132,449,595	S66N	probably benign	Het
Ehhadh	T	C	16: 21,762,178	E688G	probably damaging	Het
Emsy	T	A	7: 98,602,729	H688L	possibly damaging	Het
Emsy	G	T	7: 98,602,730	H688N	possibly damaging	Het
Endod1	A	G	9: 14,356,926	L421P	probably damaging	Het
Fam222b	C	T	11: 78,155,035	P346L	probably damaging	Het
Fam3c	G	A	6: 22,309,437	R182W	probably damaging	Het
Gck	T	C	11: 5,910,984	D29G	probably damaging	Het
Gm10320	C	A	13: 98,489,699	R59L	probably damaging	Het
Gm11127	G	T	17: 36,058,004	F61L	probably damaging	Het
Gm21798	C	T	15: 64,817,826		probably benign	Het
Gm9376	A	G	14: 118,267,545	T130A	possibly damaging	Het
Gpr153	T	A	4: 152,282,392	I334N	possibly damaging	Het
Greb1l	T	C	18: 10,509,314	L542P	probably damaging	Het
Hacl1	T	C	14: 31,640,534	E52G	probably benign	Het
Ice2	A	G	9: 69,407,353	Y128C	probably damaging	Het
Ikzf2	T	A	1: 69,542,287	I121L	probably benign	Het
Ipcef1	C	T	10: 6,919,900	A167T	probably benign	Het
Jakmip2	T	A	18: 43,582,080	D127V	possibly damaging	Het
Jph4	T	C	14: 55,114,911	T122A	probably damaging	Het
Kcns2	A	G	15: 34,838,803	E104G	probably damaging	Het
Lars2	A	C	9: 123,431,917	R384S	probably benign	Het
Lsmem1	T	A	12: 40,185,408	H3L	possibly damaging	Het
Lsmem1	G	T	12: 40,185,409	H3N	possibly damaging	Het
Mfhas1	A	C	8: 35,590,068	S566R	probably benign	Het
Mfhas1	C	G	8: 35,590,248	R626G	probably benign	Het
Mgam	A	G	6: 40,666,892	T585A	probably damaging	Het
Mmp25	T	C	17: 23,640,023	K185E	probably benign	Het
Mtch1	T	C	17: 29,338,776	I243V	probably damaging	Het
Mtcp1	A	T	X: 75,411,665	Y25*	probably null	Het
Mybl2	A	G	2: 163,059,583	T35A	probably benign	Het
Myh11	T	C	16: 14,223,880	E736G	probably damaging	Het
Myh2	T	C	11: 67,176,559	I224T	probably damaging	Het
Mymx	T	C	17: 45,601,833		probably benign	Het
Nek10	A	G	14: 14,863,454		probably null	Het
Nsd1	A	T	13: 55,246,369	K697N	probably damaging	Het
Nynrin	A	G	14: 55,872,947	D1837G	possibly damaging	Het
Olfr115	G	A	17: 37,610,277	T158I	probably benign	Het
Olfr424	T	A	1: 174,137,194	I150N	probably benign	Het
Olfr510	T	A	7: 108,667,644	I76N	probably benign	Het
Olfr593	A	T	7: 103,211,886	T9S	probably benign	Het
Olfr701	A	G	7: 106,819,007	H308R	probably benign	Het
Phf19	T	C	2: 34,911,769	T10A	probably benign	Het
Pkd1	A	T	17: 24,565,584	H368L	probably benign	Het
Plscr2	A	G	9: 92,290,755	R156G	probably damaging	Het
Ppp1r42	G	A	1: 10,000,086	R61C	probably benign	Het
Pptc7	T	G	5: 122,313,616	V45G	probably damaging	Het
Prlhr	G	A	19: 60,467,429	T233I	probably damaging	Het
Reps1	C	T	10: 18,107,714	T435I	probably damaging	Het
Ret	T	A	6: 118,153,951	T1084S	probably damaging	Het
Rgl2	T	A	17: 33,933,621	M402K	probably benign	Het
Rp2	A	G	X: 20,376,915	K43R	probably benign	Het
Rundc3b	A	T	5: 8,579,117	W95R	probably damaging	Het
Samd9l	T	C	6: 3,375,107	D718G	possibly damaging	Het
Scnn1b	G	A	7: 121,902,845	R242H	probably benign	Het
Smad4	G	T	18: 73,641,894	Q445K	probably benign	Het
Smchd1	G	T	17: 71,370,337	P1486T	probably damaging	Het
Snx25	G	T	8: 46,035,632	N895K	possibly damaging	Het
Sox2	A	G	3: 34,650,741	D109G	probably damaging	Het
Stfa2	A	T	16: 36,405,202	N38K	probably damaging	Het
Stfa2	C	A	16: 36,405,211	E35D	possibly damaging	Het
Stfa3	A	G	16: 36,450,661	L87P	probably damaging	Het
Strbp	T	C	2: 37,640,909	D111G	possibly damaging	Het
Supt20	C	A	3: 54,727,658		probably benign	Het
Svep1	A	G	4: 58,096,310	Y1437H	possibly damaging	Het
Tbx4	T	A	11: 85,911,920		probably null	Het
Tmem117	A	T	15: 95,094,551	N364I	probably damaging	Het
Tmem8	T	C	17: 26,122,220	Y766H	probably damaging	Het
Trat1	T	C	16: 48,761,379	E45G	probably damaging	Het
Trpc2	G	A	7: 102,084,119	D92N	probably damaging	Het
Ttll9	A	G	2: 153,000,236	S337G	possibly damaging	Het
Utrn	A	T	10: 12,475,274	I355N	probably damaging	Het
Vangl1	A	G	3: 102,163,466	S385P	probably benign	Het
Vmn1r209	A	G	13: 22,806,239	S94P	possibly damaging	Het
Vmn2r28	T	A	7: 5,493,811	Q14L	probably benign	Het
Vps45	A	G	3: 96,047,245		probably null	Het
Wdr48	T	C	9: 119,904,330	V81A	probably benign	Het
Xpnpep2	A	G	X: 48,125,353	N476S	probably benign	Het
Zbtb41	A	T	1: 139,446,922	K707*	probably null	Het
Zfp442	A	C	2: 150,409,063	C306W	probably damaging	Het
Zfp811	T	C	17: 32,798,142	N307S	possibly damaging	Het
Zfp976	A	G	7: 42,616,311	W17R	probably damaging	Het
Zyg11b	T	C	4: 108,266,093	T226A	possibly damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGCTTACAAAGTCTCTTAGCGC -3'
(R):5'- CTTGGAATTGTTGTCCAGATCCTG -3'

Sequencing Primer
(F):5'- TTAGCGCTTCTGACCCGGAAG -3'
(R):5'- AGATCCTGGGAGATGTCATCCAC -3'

Posted On

2014-06-23