Incidental Mutation 'R1829:Or2ag2b'
ID 207111
Institutional Source Beutler Lab
Gene Symbol Or2ag2b
Ensembl Gene ENSMUSG00000036744
Gene Name olfactory receptor family 2 subfamily AG member 2B
Synonyms 4933433E02Rik, Olfr701, GA_x6K02T2PBJ9-9195805-9196755, 4932441H21Rik, MOR283-1
MMRRC Submission 039856-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R1829 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 106413336-106419916 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106418214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 308 (H308R)
Ref Sequence ENSEMBL: ENSMUSP00000151783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075414] [ENSMUST00000080899] [ENSMUST00000166880] [ENSMUST00000217739] [ENSMUST00000219803]
AlphaFold Q9D3U9
Predicted Effect probably benign
Transcript: ENSMUST00000075414
AA Change: H308R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074868
Gene: ENSMUSG00000036744
AA Change: H308R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-46 PFAM
Pfam:7tm_1 41 290 2.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080899
SMART Domains Protein: ENSMUSP00000079704
Gene: ENSMUSG00000056863

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 300 2.9e-8 PFAM
Pfam:7tm_1 41 290 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166880
AA Change: H308R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130958
Gene: ENSMUSG00000036744
AA Change: H308R

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.8e-31 PFAM
Pfam:7tm_4 139 283 1.8e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209339
Predicted Effect probably benign
Transcript: ENSMUST00000217739
AA Change: H308R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219803
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 A T 8: 111,769,338 (GRCm39) D287V probably damaging Het
Abca12 A G 1: 71,334,188 (GRCm39) C1105R probably benign Het
Abca8b T A 11: 109,833,167 (GRCm39) N1178Y probably damaging Het
Abhd12 A G 2: 150,685,318 (GRCm39) L189P probably damaging Het
Acap2 G T 16: 30,929,752 (GRCm39) N435K probably damaging Het
Adam6b G T 12: 113,453,545 (GRCm39) G121C probably damaging Het
Adgrb1 C A 15: 74,452,435 (GRCm39) C200* probably null Het
Agbl5 T C 5: 31,060,408 (GRCm39) S730P possibly damaging Het
Ahsg G A 16: 22,711,078 (GRCm39) probably benign Het
Aldh9a1 A T 1: 167,189,423 (GRCm39) K390N probably benign Het
Alpk2 T A 18: 65,427,165 (GRCm39) H1857L possibly damaging Het
Apip T A 2: 102,919,007 (GRCm39) N102K probably benign Het
Asxl2 T C 12: 3,507,125 (GRCm39) S106P probably damaging Het
Atp2b2 G T 6: 113,750,329 (GRCm39) R677S probably damaging Het
Barhl1 A C 2: 28,799,857 (GRCm39) M256R probably damaging Het
Cacnb2 A T 2: 14,990,775 (GRCm39) Q619L possibly damaging Het
Ccdc137 C T 11: 120,349,038 (GRCm39) P23L probably benign Het
Cdh11 A T 8: 103,361,273 (GRCm39) N688K possibly damaging Het
Cdh18 C T 15: 23,173,938 (GRCm39) P51S probably damaging Het
Cdin1 G T 2: 115,473,173 (GRCm39) R101L possibly damaging Het
Cfhr1 A T 1: 139,481,338 (GRCm39) Y181N probably damaging Het
Chmp3 A G 6: 71,537,923 (GRCm39) D50G probably benign Het
Crem T C 18: 3,295,037 (GRCm39) probably null Het
Cyb561a3 G A 19: 10,559,757 (GRCm39) W27* probably null Het
Cyp2d12 C A 15: 82,442,257 (GRCm39) N297K possibly damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnah12 T A 14: 26,522,032 (GRCm39) N1948K probably damaging Het
Dnah12 T C 14: 26,494,980 (GRCm39) L1346P probably damaging Het
Dsp T G 13: 38,377,171 (GRCm39) L1652R probably damaging Het
Dstyk G A 1: 132,377,333 (GRCm39) S66N probably benign Het
Ehhadh T C 16: 21,580,928 (GRCm39) E688G probably damaging Het
Emsy G T 7: 98,251,937 (GRCm39) H688N possibly damaging Het
Emsy T A 7: 98,251,936 (GRCm39) H688L possibly damaging Het
Endod1 A G 9: 14,268,222 (GRCm39) L421P probably damaging Het
Fam222b C T 11: 78,045,861 (GRCm39) P346L probably damaging Het
Fam3c G A 6: 22,309,436 (GRCm39) R182W probably damaging Het
Gck T C 11: 5,860,984 (GRCm39) D29G probably damaging Het
Gm10320 C A 13: 98,626,207 (GRCm39) R59L probably damaging Het
Gm21798 C T 15: 64,689,675 (GRCm39) probably benign Het
Gm9376 A G 14: 118,504,957 (GRCm39) T130A possibly damaging Het
Gpr153 T A 4: 152,366,849 (GRCm39) I334N possibly damaging Het
Greb1l T C 18: 10,509,314 (GRCm39) L542P probably damaging Het
H2-T15 G T 17: 36,368,896 (GRCm39) F61L probably damaging Het
Hacl1 T C 14: 31,362,491 (GRCm39) E52G probably benign Het
Ice2 A G 9: 69,314,635 (GRCm39) Y128C probably damaging Het
Ikzf2 T A 1: 69,581,446 (GRCm39) I121L probably benign Het
Ipcef1 C T 10: 6,869,900 (GRCm39) A167T probably benign Het
Jakmip2 T A 18: 43,715,145 (GRCm39) D127V possibly damaging Het
Jph4 T C 14: 55,352,368 (GRCm39) T122A probably damaging Het
Kcns2 A G 15: 34,838,949 (GRCm39) E104G probably damaging Het
Lars2 A C 9: 123,260,982 (GRCm39) R384S probably benign Het
Lsmem1 T A 12: 40,235,407 (GRCm39) H3L possibly damaging Het
Lsmem1 G T 12: 40,235,408 (GRCm39) H3N possibly damaging Het
Ly6g2 T G 15: 75,088,605 (GRCm39) probably null Het
Mfhas1 A C 8: 36,057,222 (GRCm39) S566R probably benign Het
Mfhas1 C G 8: 36,057,402 (GRCm39) R626G probably benign Het
Mgam A G 6: 40,643,826 (GRCm39) T585A probably damaging Het
Mmp25 T C 17: 23,858,997 (GRCm39) K185E probably benign Het
Mtch1 T C 17: 29,557,750 (GRCm39) I243V probably damaging Het
Mtcp1 A T X: 74,455,271 (GRCm39) Y25* probably null Het
Mybl2 A G 2: 162,901,503 (GRCm39) T35A probably benign Het
Myh11 T C 16: 14,041,744 (GRCm39) E736G probably damaging Het
Myh2 T C 11: 67,067,385 (GRCm39) I224T probably damaging Het
Mymx T C 17: 45,912,759 (GRCm39) probably benign Het
Nek10 A G 14: 14,863,454 (GRCm38) probably null Het
Nsd1 A T 13: 55,394,182 (GRCm39) K697N probably damaging Het
Nynrin A G 14: 56,110,404 (GRCm39) D1837G possibly damaging Het
Or14j4 G A 17: 37,921,168 (GRCm39) T158I probably benign Het
Or52s1 A T 7: 102,861,093 (GRCm39) T9S probably benign Het
Or5p81 T A 7: 108,266,851 (GRCm39) I76N probably benign Het
Or6k4 T A 1: 173,964,760 (GRCm39) I150N probably benign Het
Pgap6 T C 17: 26,341,194 (GRCm39) Y766H probably damaging Het
Phf19 T C 2: 34,801,781 (GRCm39) T10A probably benign Het
Pkd1 A T 17: 24,784,558 (GRCm39) H368L probably benign Het
Plscr2 A G 9: 92,172,808 (GRCm39) R156G probably damaging Het
Ppp1r42 G A 1: 10,070,311 (GRCm39) R61C probably benign Het
Pptc7 T G 5: 122,451,679 (GRCm39) V45G probably damaging Het
Prlhr G A 19: 60,455,867 (GRCm39) T233I probably damaging Het
Prr23a4 T A 9: 98,785,446 (GRCm39) I37N possibly damaging Het
Reps1 C T 10: 17,983,462 (GRCm39) T435I probably damaging Het
Ret T A 6: 118,130,912 (GRCm39) T1084S probably damaging Het
Rgl2 T A 17: 34,152,595 (GRCm39) M402K probably benign Het
Rp2 A G X: 20,243,154 (GRCm39) K43R probably benign Het
Rundc3b A T 5: 8,629,117 (GRCm39) W95R probably damaging Het
Samd9l T C 6: 3,375,107 (GRCm39) D718G possibly damaging Het
Scnn1b G A 7: 121,502,068 (GRCm39) R242H probably benign Het
Smad4 G T 18: 73,774,965 (GRCm39) Q445K probably benign Het
Smchd1 G T 17: 71,677,332 (GRCm39) P1486T probably damaging Het
Snx25 G T 8: 46,488,669 (GRCm39) N895K possibly damaging Het
Sox2 A G 3: 34,704,890 (GRCm39) D109G probably damaging Het
Stfa2 A T 16: 36,225,564 (GRCm39) N38K probably damaging Het
Stfa2 C A 16: 36,225,573 (GRCm39) E35D possibly damaging Het
Stfa3 A G 16: 36,271,023 (GRCm39) L87P probably damaging Het
Strbp T C 2: 37,530,921 (GRCm39) D111G possibly damaging Het
Supt20 C A 3: 54,635,079 (GRCm39) probably benign Het
Svep1 A G 4: 58,096,310 (GRCm39) Y1437H possibly damaging Het
Tbx4 T A 11: 85,802,746 (GRCm39) probably null Het
Tmem117 A T 15: 94,992,432 (GRCm39) N364I probably damaging Het
Trat1 T C 16: 48,581,742 (GRCm39) E45G probably damaging Het
Trpc2 G A 7: 101,733,326 (GRCm39) D92N probably damaging Het
Trpm1 G A 7: 63,876,530 (GRCm39) D528N probably damaging Het
Ttll9 A G 2: 152,842,156 (GRCm39) S337G possibly damaging Het
Utrn A T 10: 12,351,018 (GRCm39) I355N probably damaging Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn1r209 A G 13: 22,990,409 (GRCm39) S94P possibly damaging Het
Vmn2r28 T A 7: 5,496,810 (GRCm39) Q14L probably benign Het
Vps45 A G 3: 95,954,557 (GRCm39) probably null Het
Wdr48 T C 9: 119,733,396 (GRCm39) V81A probably benign Het
Xpnpep2 A G X: 47,214,230 (GRCm39) N476S probably benign Het
Zbtb41 A T 1: 139,374,660 (GRCm39) K707* probably null Het
Zfp442 A C 2: 150,250,983 (GRCm39) C306W probably damaging Het
Zfp811 T C 17: 33,017,116 (GRCm39) N307S possibly damaging Het
Zfp976 A G 7: 42,265,735 (GRCm39) W17R probably damaging Het
Zyg11b T C 4: 108,123,290 (GRCm39) T226A possibly damaging Het
Other mutations in Or2ag2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Or2ag2b APN 7 106,417,827 (GRCm39) missense probably damaging 1.00
IGL01972:Or2ag2b APN 7 106,417,739 (GRCm39) missense probably benign 0.01
IGL02541:Or2ag2b APN 7 106,417,809 (GRCm39) missense probably benign 0.34
R0276:Or2ag2b UTSW 7 106,417,904 (GRCm39) missense probably benign 0.00
R0345:Or2ag2b UTSW 7 106,417,908 (GRCm39) missense probably benign 0.38
R0467:Or2ag2b UTSW 7 106,417,568 (GRCm39) missense possibly damaging 0.49
R3116:Or2ag2b UTSW 7 106,417,571 (GRCm39) missense probably damaging 0.98
R3870:Or2ag2b UTSW 7 106,418,047 (GRCm39) nonsense probably null
R5267:Or2ag2b UTSW 7 106,418,015 (GRCm39) missense probably damaging 1.00
R6036:Or2ag2b UTSW 7 106,417,667 (GRCm39) missense probably damaging 1.00
R6036:Or2ag2b UTSW 7 106,417,667 (GRCm39) missense probably damaging 1.00
R7229:Or2ag2b UTSW 7 106,418,202 (GRCm39) missense probably damaging 0.97
R7230:Or2ag2b UTSW 7 106,417,386 (GRCm39) missense possibly damaging 0.78
R7231:Or2ag2b UTSW 7 106,417,650 (GRCm39) missense probably damaging 1.00
R7419:Or2ag2b UTSW 7 106,417,551 (GRCm39) missense possibly damaging 0.89
R7537:Or2ag2b UTSW 7 106,417,581 (GRCm39) missense probably damaging 1.00
R8468:Or2ag2b UTSW 7 106,418,046 (GRCm39) missense possibly damaging 0.66
R9246:Or2ag2b UTSW 7 106,417,938 (GRCm39) missense probably benign 0.00
R9300:Or2ag2b UTSW 7 106,418,111 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTTGACTGTGGTTGGGAT -3'
(R):5'- CTACTGTGTTGGGGACATCTGTT -3'

Sequencing Primer
(F):5'- ATGTTCTATGGGGGTGCCAC -3'
(R):5'- CAAACTCACATGGCTGGTTG -3'
Posted On 2014-06-23