Incidental Mutation 'R1829:Cdh11'
ID 207119
Institutional Source Beutler Lab
Gene Symbol Cdh11
Ensembl Gene ENSMUSG00000031673
Gene Name cadherin 11
Synonyms osteoblast-cadherin, Cad11, OB-cadherin
MMRRC Submission 039856-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1829 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 102632095-102785642 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102634641 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 688 (N688K)
Ref Sequence ENSEMBL: ENSMUSP00000074681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075190]
AlphaFold P55288
PDB Structure Crystal structure of mouse cadherin-11 EC1 [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-11 EC1-2 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075190
AA Change: N688K

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074681
Gene: ENSMUSG00000031673
AA Change: N688K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 76 157 1.99e-19 SMART
CA 181 266 3.33e-30 SMART
CA 290 382 3.37e-17 SMART
CA 405 486 1.14e-23 SMART
CA 513 600 4.77e-8 SMART
transmembrane domain 618 640 N/A INTRINSIC
Pfam:Cadherin_C 643 788 1.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210578
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a type II classical cadherin and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is an integral membrane protein that mediates calcium-dependent cell-cell adhesion, specifically in the context of bone development. Homozygous knockout mice for this gene exhibit impaired synovium development and reduced bone density. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutant animals appear healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T A 9: 98,903,393 (GRCm38) I37N possibly damaging Het
Aars A T 8: 111,042,706 (GRCm38) D287V probably damaging Het
Abca12 A G 1: 71,295,029 (GRCm38) C1105R probably benign Het
Abca8b T A 11: 109,942,341 (GRCm38) N1178Y probably damaging Het
Abhd12 A G 2: 150,843,398 (GRCm38) L189P probably damaging Het
Acap2 G T 16: 31,110,934 (GRCm38) N435K probably damaging Het
Adam6b G T 12: 113,489,925 (GRCm38) G121C probably damaging Het
Adgrb1 C A 15: 74,580,586 (GRCm38) C200* probably null Het
Agbl5 T C 5: 30,903,064 (GRCm38) S730P possibly damaging Het
Ahsg G A 16: 22,892,328 (GRCm38) probably benign Het
Aldh9a1 A T 1: 167,361,854 (GRCm38) K390N probably benign Het
Alpk2 T A 18: 65,294,094 (GRCm38) H1857L possibly damaging Het
Apip T A 2: 103,088,662 (GRCm38) N102K probably benign Het
Asxl2 T C 12: 3,457,125 (GRCm38) S106P probably damaging Het
Atp2b2 G T 6: 113,773,368 (GRCm38) R677S probably damaging Het
Barhl1 A C 2: 28,909,845 (GRCm38) M256R probably damaging Het
BC025446 T G 15: 75,216,756 (GRCm38) probably null Het
BC052040 G T 2: 115,642,692 (GRCm38) R101L possibly damaging Het
Cacnb2 A T 2: 14,985,964 (GRCm38) Q619L possibly damaging Het
Ccdc137 C T 11: 120,458,212 (GRCm38) P23L probably benign Het
Cdh18 C T 15: 23,173,852 (GRCm38) P51S probably damaging Het
Cfhr1 A T 1: 139,553,600 (GRCm38) Y181N probably damaging Het
Chmp3 A G 6: 71,560,939 (GRCm38) D50G probably benign Het
Crem T C 18: 3,295,037 (GRCm38) probably null Het
Cyb561a3 G A 19: 10,582,393 (GRCm38) W27* probably null Het
Cyp2d12 C A 15: 82,558,056 (GRCm38) N297K possibly damaging Het
Dclk2 C T 3: 86,805,639 (GRCm38) R503Q possibly damaging Het
Dnah12 T C 14: 26,773,023 (GRCm38) L1346P probably damaging Het
Dnah12 T A 14: 26,800,075 (GRCm38) N1948K probably damaging Het
Dsp T G 13: 38,193,195 (GRCm38) L1652R probably damaging Het
Dstyk G A 1: 132,449,595 (GRCm38) S66N probably benign Het
Ehhadh T C 16: 21,762,178 (GRCm38) E688G probably damaging Het
Emsy T A 7: 98,602,729 (GRCm38) H688L possibly damaging Het
Emsy G T 7: 98,602,730 (GRCm38) H688N possibly damaging Het
Endod1 A G 9: 14,356,926 (GRCm38) L421P probably damaging Het
Fam222b C T 11: 78,155,035 (GRCm38) P346L probably damaging Het
Fam3c G A 6: 22,309,437 (GRCm38) R182W probably damaging Het
Gck T C 11: 5,910,984 (GRCm38) D29G probably damaging Het
Gm10320 C A 13: 98,489,699 (GRCm38) R59L probably damaging Het
Gm11127 G T 17: 36,058,004 (GRCm38) F61L probably damaging Het
Gm21798 C T 15: 64,817,826 (GRCm38) probably benign Het
Gm9376 A G 14: 118,267,545 (GRCm38) T130A possibly damaging Het
Gpr153 T A 4: 152,282,392 (GRCm38) I334N possibly damaging Het
Greb1l T C 18: 10,509,314 (GRCm38) L542P probably damaging Het
Hacl1 T C 14: 31,640,534 (GRCm38) E52G probably benign Het
Ice2 A G 9: 69,407,353 (GRCm38) Y128C probably damaging Het
Ikzf2 T A 1: 69,542,287 (GRCm38) I121L probably benign Het
Ipcef1 C T 10: 6,919,900 (GRCm38) A167T probably benign Het
Jakmip2 T A 18: 43,582,080 (GRCm38) D127V possibly damaging Het
Jph4 T C 14: 55,114,911 (GRCm38) T122A probably damaging Het
Kcns2 A G 15: 34,838,803 (GRCm38) E104G probably damaging Het
Lars2 A C 9: 123,431,917 (GRCm38) R384S probably benign Het
Lsmem1 T A 12: 40,185,408 (GRCm38) H3L possibly damaging Het
Lsmem1 G T 12: 40,185,409 (GRCm38) H3N possibly damaging Het
Mfhas1 A C 8: 35,590,068 (GRCm38) S566R probably benign Het
Mfhas1 C G 8: 35,590,248 (GRCm38) R626G probably benign Het
Mgam A G 6: 40,666,892 (GRCm38) T585A probably damaging Het
Mmp25 T C 17: 23,640,023 (GRCm38) K185E probably benign Het
Mtch1 T C 17: 29,338,776 (GRCm38) I243V probably damaging Het
Mtcp1 A T X: 75,411,665 (GRCm38) Y25* probably null Het
Mybl2 A G 2: 163,059,583 (GRCm38) T35A probably benign Het
Myh11 T C 16: 14,223,880 (GRCm38) E736G probably damaging Het
Myh2 T C 11: 67,176,559 (GRCm38) I224T probably damaging Het
Mymx T C 17: 45,601,833 (GRCm38) probably benign Het
Nek10 A G 14: 14,863,454 (GRCm38) probably null Het
Nsd1 A T 13: 55,246,369 (GRCm38) K697N probably damaging Het
Nynrin A G 14: 55,872,947 (GRCm38) D1837G possibly damaging Het
Olfr115 G A 17: 37,610,277 (GRCm38) T158I probably benign Het
Olfr424 T A 1: 174,137,194 (GRCm38) I150N probably benign Het
Olfr510 T A 7: 108,667,644 (GRCm38) I76N probably benign Het
Olfr593 A T 7: 103,211,886 (GRCm38) T9S probably benign Het
Olfr701 A G 7: 106,819,007 (GRCm38) H308R probably benign Het
Phf19 T C 2: 34,911,769 (GRCm38) T10A probably benign Het
Pkd1 A T 17: 24,565,584 (GRCm38) H368L probably benign Het
Plscr2 A G 9: 92,290,755 (GRCm38) R156G probably damaging Het
Ppp1r42 G A 1: 10,000,086 (GRCm38) R61C probably benign Het
Pptc7 T G 5: 122,313,616 (GRCm38) V45G probably damaging Het
Prlhr G A 19: 60,467,429 (GRCm38) T233I probably damaging Het
Reps1 C T 10: 18,107,714 (GRCm38) T435I probably damaging Het
Ret T A 6: 118,153,951 (GRCm38) T1084S probably damaging Het
Rgl2 T A 17: 33,933,621 (GRCm38) M402K probably benign Het
Rp2 A G X: 20,376,915 (GRCm38) K43R probably benign Het
Rundc3b A T 5: 8,579,117 (GRCm38) W95R probably damaging Het
Samd9l T C 6: 3,375,107 (GRCm38) D718G possibly damaging Het
Scnn1b G A 7: 121,902,845 (GRCm38) R242H probably benign Het
Smad4 G T 18: 73,641,894 (GRCm38) Q445K probably benign Het
Smchd1 G T 17: 71,370,337 (GRCm38) P1486T probably damaging Het
Snx25 G T 8: 46,035,632 (GRCm38) N895K possibly damaging Het
Sox2 A G 3: 34,650,741 (GRCm38) D109G probably damaging Het
Stfa2 A T 16: 36,405,202 (GRCm38) N38K probably damaging Het
Stfa2 C A 16: 36,405,211 (GRCm38) E35D possibly damaging Het
Stfa3 A G 16: 36,450,661 (GRCm38) L87P probably damaging Het
Strbp T C 2: 37,640,909 (GRCm38) D111G possibly damaging Het
Supt20 C A 3: 54,727,658 (GRCm38) probably benign Het
Svep1 A G 4: 58,096,310 (GRCm38) Y1437H possibly damaging Het
Tbx4 T A 11: 85,911,920 (GRCm38) probably null Het
Tmem117 A T 15: 95,094,551 (GRCm38) N364I probably damaging Het
Tmem8 T C 17: 26,122,220 (GRCm38) Y766H probably damaging Het
Trat1 T C 16: 48,761,379 (GRCm38) E45G probably damaging Het
Trpc2 G A 7: 102,084,119 (GRCm38) D92N probably damaging Het
Trpm1 G A 7: 64,226,782 (GRCm38) D528N probably damaging Het
Ttll9 A G 2: 153,000,236 (GRCm38) S337G possibly damaging Het
Utrn A T 10: 12,475,274 (GRCm38) I355N probably damaging Het
Vangl1 A G 3: 102,163,466 (GRCm38) S385P probably benign Het
Vmn1r209 A G 13: 22,806,239 (GRCm38) S94P possibly damaging Het
Vmn2r28 T A 7: 5,493,811 (GRCm38) Q14L probably benign Het
Vps45 A G 3: 96,047,245 (GRCm38) probably null Het
Wdr48 T C 9: 119,904,330 (GRCm38) V81A probably benign Het
Xpnpep2 A G X: 48,125,353 (GRCm38) N476S probably benign Het
Zbtb41 A T 1: 139,446,922 (GRCm38) K707* probably null Het
Zfp442 A C 2: 150,409,063 (GRCm38) C306W probably damaging Het
Zfp811 T C 17: 32,798,142 (GRCm38) N307S possibly damaging Het
Zfp976 A G 7: 42,616,311 (GRCm38) W17R probably damaging Het
Zyg11b T C 4: 108,266,093 (GRCm38) T226A possibly damaging Het
Other mutations in Cdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Cdh11 APN 8 102,650,649 (GRCm38) missense probably damaging 1.00
IGL01019:Cdh11 APN 8 102,679,745 (GRCm38) missense probably benign
IGL01286:Cdh11 APN 8 102,664,629 (GRCm38) missense probably damaging 0.98
IGL01556:Cdh11 APN 8 102,679,644 (GRCm38) missense probably damaging 1.00
IGL01964:Cdh11 APN 8 102,664,743 (GRCm38) missense probably benign 0.03
IGL02322:Cdh11 APN 8 102,647,519 (GRCm38) missense probably benign 0.01
IGL03094:Cdh11 APN 8 102,658,403 (GRCm38) missense probably benign
IGL03110:Cdh11 APN 8 102,673,870 (GRCm38) missense probably damaging 1.00
IGL03391:Cdh11 APN 8 102,674,023 (GRCm38) missense possibly damaging 0.89
R0401:Cdh11 UTSW 8 102,674,006 (GRCm38) missense probably damaging 1.00
R0466:Cdh11 UTSW 8 102,670,058 (GRCm38) missense possibly damaging 0.89
R0731:Cdh11 UTSW 8 102,668,019 (GRCm38) missense probably damaging 1.00
R0925:Cdh11 UTSW 8 102,634,724 (GRCm38) missense probably damaging 1.00
R1597:Cdh11 UTSW 8 102,650,711 (GRCm38) missense probably benign 0.06
R1624:Cdh11 UTSW 8 102,664,601 (GRCm38) splice site probably benign
R2029:Cdh11 UTSW 8 102,679,772 (GRCm38) missense probably benign 0.00
R4191:Cdh11 UTSW 8 102,650,748 (GRCm38) missense probably damaging 0.98
R4270:Cdh11 UTSW 8 102,664,626 (GRCm38) missense possibly damaging 0.69
R4271:Cdh11 UTSW 8 102,664,626 (GRCm38) missense possibly damaging 0.69
R4455:Cdh11 UTSW 8 102,647,823 (GRCm38) missense probably benign
R4516:Cdh11 UTSW 8 102,673,962 (GRCm38) missense possibly damaging 0.59
R4900:Cdh11 UTSW 8 102,647,458 (GRCm38) splice site probably null
R5441:Cdh11 UTSW 8 102,647,546 (GRCm38) missense probably benign 0.11
R5699:Cdh11 UTSW 8 102,634,543 (GRCm38) missense probably damaging 0.96
R6170:Cdh11 UTSW 8 102,634,810 (GRCm38) missense probably benign 0.00
R6846:Cdh11 UTSW 8 102,664,644 (GRCm38) missense probably damaging 0.97
R7018:Cdh11 UTSW 8 102,634,321 (GRCm38) missense possibly damaging 0.82
R7095:Cdh11 UTSW 8 102,658,267 (GRCm38) missense probably damaging 1.00
R7497:Cdh11 UTSW 8 102,673,824 (GRCm38) missense probably benign 0.00
R7632:Cdh11 UTSW 8 102,673,883 (GRCm38) missense probably damaging 0.99
R7715:Cdh11 UTSW 8 102,664,714 (GRCm38) missense possibly damaging 0.66
R8321:Cdh11 UTSW 8 102,634,784 (GRCm38) missense probably damaging 0.99
R8529:Cdh11 UTSW 8 102,664,755 (GRCm38) missense probably benign 0.01
R8530:Cdh11 UTSW 8 102,664,755 (GRCm38) missense probably benign 0.01
R8682:Cdh11 UTSW 8 102,650,716 (GRCm38) missense probably benign 0.24
R9105:Cdh11 UTSW 8 102,634,336 (GRCm38) missense probably damaging 0.99
R9404:Cdh11 UTSW 8 102,679,622 (GRCm38) missense probably damaging 1.00
R9660:Cdh11 UTSW 8 102,658,247 (GRCm38) missense possibly damaging 0.70
R9684:Cdh11 UTSW 8 102,664,695 (GRCm38) missense probably benign 0.04
R9721:Cdh11 UTSW 8 102,679,625 (GRCm38) missense probably damaging 1.00
R9802:Cdh11 UTSW 8 102,664,644 (GRCm38) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTCCAGGTCTGAGTCTGTC -3'
(R):5'- TTCTACAGTCATCGTTGTGCTG -3'

Sequencing Primer
(F):5'- TCTGTCGTGGCAGACTCCAAG -3'
(R):5'- GTTTGTTACCCTGAGGAGGCAAAAG -3'
Posted On 2014-06-23