Incidental Mutation 'R1829:Aars'
ID207120
Institutional Source Beutler Lab
Gene Symbol Aars
Ensembl Gene ENSMUSG00000031960
Gene Namealanyl-tRNA synthetase
Synonyms
MMRRC Submission 039856-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R1829 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111033144-111057664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111042706 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 287 (D287V)
Ref Sequence ENSEMBL: ENSMUSP00000034441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034441]
Predicted Effect probably damaging
Transcript: ENSMUST00000034441
AA Change: D287V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034441
Gene: ENSMUSG00000031960
AA Change: D287V

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 9 597 9.2e-228 PFAM
tRNA_SAD 694 753 5.97e-18 SMART
Pfam:DHHA1 885 957 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174930
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous point mutation (A734E) exhibit a rough sticky coat, follicular dystrophy, patchy hair loss, progressive ataxia, and Purkinje cell degeneration. Homozygotes for a targeted point mutation (C723A) die by mid-gestation, while heterozygotes show mild Purkinje cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T A 9: 98,903,393 I37N possibly damaging Het
Abca12 A G 1: 71,295,029 C1105R probably benign Het
Abca8b T A 11: 109,942,341 N1178Y probably damaging Het
Abhd12 A G 2: 150,843,398 L189P probably damaging Het
Acap2 G T 16: 31,110,934 N435K probably damaging Het
Adam6b G T 12: 113,489,925 G121C probably damaging Het
Adgrb1 C A 15: 74,580,586 C200* probably null Het
Agbl5 T C 5: 30,903,064 S730P possibly damaging Het
Ahsg G A 16: 22,892,328 probably benign Het
Aldh9a1 A T 1: 167,361,854 K390N probably benign Het
Alpk2 T A 18: 65,294,094 H1857L possibly damaging Het
Apip T A 2: 103,088,662 N102K probably benign Het
Asxl2 T C 12: 3,457,125 S106P probably damaging Het
Atp2b2 G T 6: 113,773,368 R677S probably damaging Het
Barhl1 A C 2: 28,909,845 M256R probably damaging Het
BC025446 T G 15: 75,216,756 probably null Het
BC052040 G T 2: 115,642,692 R101L possibly damaging Het
Cacnb2 A T 2: 14,985,964 Q619L possibly damaging Het
Ccdc137 C T 11: 120,458,212 P23L probably benign Het
Cdh11 A T 8: 102,634,641 N688K possibly damaging Het
Cdh18 C T 15: 23,173,852 P51S probably damaging Het
Cfhr1 A T 1: 139,553,600 Y181N probably damaging Het
Chmp3 A G 6: 71,560,939 D50G probably benign Het
Crem T C 18: 3,295,037 probably null Het
Cyb561a3 G A 19: 10,582,393 W27* probably null Het
Cyp2d12 C A 15: 82,558,056 N297K possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 T C 14: 26,773,023 L1346P probably damaging Het
Dnah12 T A 14: 26,800,075 N1948K probably damaging Het
Dsp T G 13: 38,193,195 L1652R probably damaging Het
Dstyk G A 1: 132,449,595 S66N probably benign Het
Ehhadh T C 16: 21,762,178 E688G probably damaging Het
Emsy T A 7: 98,602,729 H688L possibly damaging Het
Emsy G T 7: 98,602,730 H688N possibly damaging Het
Endod1 A G 9: 14,356,926 L421P probably damaging Het
Fam222b C T 11: 78,155,035 P346L probably damaging Het
Fam3c G A 6: 22,309,437 R182W probably damaging Het
Gck T C 11: 5,910,984 D29G probably damaging Het
Gm10320 C A 13: 98,489,699 R59L probably damaging Het
Gm11127 G T 17: 36,058,004 F61L probably damaging Het
Gm21798 C T 15: 64,817,826 probably benign Het
Gm9376 A G 14: 118,267,545 T130A possibly damaging Het
Gpr153 T A 4: 152,282,392 I334N possibly damaging Het
Greb1l T C 18: 10,509,314 L542P probably damaging Het
Hacl1 T C 14: 31,640,534 E52G probably benign Het
Ice2 A G 9: 69,407,353 Y128C probably damaging Het
Ikzf2 T A 1: 69,542,287 I121L probably benign Het
Ipcef1 C T 10: 6,919,900 A167T probably benign Het
Jakmip2 T A 18: 43,582,080 D127V possibly damaging Het
Jph4 T C 14: 55,114,911 T122A probably damaging Het
Kcns2 A G 15: 34,838,803 E104G probably damaging Het
Lars2 A C 9: 123,431,917 R384S probably benign Het
Lsmem1 T A 12: 40,185,408 H3L possibly damaging Het
Lsmem1 G T 12: 40,185,409 H3N possibly damaging Het
Mfhas1 A C 8: 35,590,068 S566R probably benign Het
Mfhas1 C G 8: 35,590,248 R626G probably benign Het
Mgam A G 6: 40,666,892 T585A probably damaging Het
Mmp25 T C 17: 23,640,023 K185E probably benign Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Mtcp1 A T X: 75,411,665 Y25* probably null Het
Mybl2 A G 2: 163,059,583 T35A probably benign Het
Myh11 T C 16: 14,223,880 E736G probably damaging Het
Myh2 T C 11: 67,176,559 I224T probably damaging Het
Mymx T C 17: 45,601,833 probably benign Het
Nek10 A G 14: 14,863,454 probably null Het
Nsd1 A T 13: 55,246,369 K697N probably damaging Het
Nynrin A G 14: 55,872,947 D1837G possibly damaging Het
Olfr115 G A 17: 37,610,277 T158I probably benign Het
Olfr424 T A 1: 174,137,194 I150N probably benign Het
Olfr510 T A 7: 108,667,644 I76N probably benign Het
Olfr593 A T 7: 103,211,886 T9S probably benign Het
Olfr701 A G 7: 106,819,007 H308R probably benign Het
Phf19 T C 2: 34,911,769 T10A probably benign Het
Pkd1 A T 17: 24,565,584 H368L probably benign Het
Plscr2 A G 9: 92,290,755 R156G probably damaging Het
Ppp1r42 G A 1: 10,000,086 R61C probably benign Het
Pptc7 T G 5: 122,313,616 V45G probably damaging Het
Prlhr G A 19: 60,467,429 T233I probably damaging Het
Reps1 C T 10: 18,107,714 T435I probably damaging Het
Ret T A 6: 118,153,951 T1084S probably damaging Het
Rgl2 T A 17: 33,933,621 M402K probably benign Het
Rp2 A G X: 20,376,915 K43R probably benign Het
Rundc3b A T 5: 8,579,117 W95R probably damaging Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Scnn1b G A 7: 121,902,845 R242H probably benign Het
Smad4 G T 18: 73,641,894 Q445K probably benign Het
Smchd1 G T 17: 71,370,337 P1486T probably damaging Het
Snx25 G T 8: 46,035,632 N895K possibly damaging Het
Sox2 A G 3: 34,650,741 D109G probably damaging Het
Stfa2 A T 16: 36,405,202 N38K probably damaging Het
Stfa2 C A 16: 36,405,211 E35D possibly damaging Het
Stfa3 A G 16: 36,450,661 L87P probably damaging Het
Strbp T C 2: 37,640,909 D111G possibly damaging Het
Supt20 C A 3: 54,727,658 probably benign Het
Svep1 A G 4: 58,096,310 Y1437H possibly damaging Het
Tbx4 T A 11: 85,911,920 probably null Het
Tmem117 A T 15: 95,094,551 N364I probably damaging Het
Tmem8 T C 17: 26,122,220 Y766H probably damaging Het
Trat1 T C 16: 48,761,379 E45G probably damaging Het
Trpc2 G A 7: 102,084,119 D92N probably damaging Het
Trpm1 G A 7: 64,226,782 D528N probably damaging Het
Ttll9 A G 2: 153,000,236 S337G possibly damaging Het
Utrn A T 10: 12,475,274 I355N probably damaging Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn1r209 A G 13: 22,806,239 S94P possibly damaging Het
Vmn2r28 T A 7: 5,493,811 Q14L probably benign Het
Vps45 A G 3: 96,047,245 probably null Het
Wdr48 T C 9: 119,904,330 V81A probably benign Het
Xpnpep2 A G X: 48,125,353 N476S probably benign Het
Zbtb41 A T 1: 139,446,922 K707* probably null Het
Zfp442 A C 2: 150,409,063 C306W probably damaging Het
Zfp811 T C 17: 32,798,142 N307S possibly damaging Het
Zfp976 A G 7: 42,616,311 W17R probably damaging Het
Zyg11b T C 4: 108,266,093 T226A possibly damaging Het
Other mutations in Aars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Aars APN 8 111047972 missense possibly damaging 0.86
IGL00731:Aars APN 8 111044869 splice site probably benign
IGL00826:Aars APN 8 111040300 missense probably damaging 1.00
IGL01521:Aars APN 8 111043787 missense possibly damaging 0.85
IGL01885:Aars APN 8 111047943 missense possibly damaging 0.89
IGL01920:Aars APN 8 111043246 missense probably damaging 1.00
IGL01934:Aars APN 8 111048018 missense probably damaging 0.98
IGL02013:Aars APN 8 111047066 missense probably damaging 0.99
IGL02489:Aars APN 8 111054215 unclassified probably benign
IGL02683:Aars APN 8 111052531 unclassified probably benign
IGL03084:Aars APN 8 111041629 missense probably damaging 1.00
H8786:Aars UTSW 8 111045555 missense probably benign
R0037:Aars UTSW 8 111043259 missense possibly damaging 0.77
R0049:Aars UTSW 8 111052451 missense possibly damaging 0.75
R0049:Aars UTSW 8 111052451 missense possibly damaging 0.75
R0577:Aars UTSW 8 111043278 missense probably benign 0.10
R1183:Aars UTSW 8 111041574 nonsense probably null
R1642:Aars UTSW 8 111043250 missense possibly damaging 0.77
R1857:Aars UTSW 8 111040157 missense probably damaging 0.99
R2190:Aars UTSW 8 111040153 missense probably damaging 1.00
R2303:Aars UTSW 8 111052502 missense possibly damaging 0.84
R3918:Aars UTSW 8 111040142 missense probably damaging 1.00
R4001:Aars UTSW 8 111041602 missense probably damaging 1.00
R4434:Aars UTSW 8 111054621 missense probably null 0.74
R4909:Aars UTSW 8 111055083 missense probably damaging 1.00
R4970:Aars UTSW 8 111043679 missense probably benign 0.00
R5639:Aars UTSW 8 111043234 missense probably benign 0.01
R5991:Aars UTSW 8 111050400 missense probably damaging 1.00
R6403:Aars UTSW 8 111042249 missense possibly damaging 0.87
R6521:Aars UTSW 8 111043336 missense probably benign 0.01
R6956:Aars UTSW 8 111055130 missense probably benign 0.38
R7378:Aars UTSW 8 111042342 missense probably damaging 1.00
R7625:Aars UTSW 8 111046955 missense probably damaging 0.99
R7745:Aars UTSW 8 111041657 missense probably damaging 1.00
R7792:Aars UTSW 8 111043264 missense possibly damaging 0.75
R7860:Aars UTSW 8 111049861 missense probably benign 0.16
R8109:Aars UTSW 8 111040652 missense probably benign
R8197:Aars UTSW 8 111053996 missense probably benign 0.44
R8322:Aars UTSW 8 111045528 missense possibly damaging 0.93
R8343:Aars UTSW 8 111040729 missense probably damaging 1.00
R8683:Aars UTSW 8 111042249 missense possibly damaging 0.87
R8783:Aars UTSW 8 111049883 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTGCACCATTACTGTCAG -3'
(R):5'- AAGTATGGCTTTGAGCTCCAGTC -3'

Sequencing Primer
(F):5'- CTCTCTGAGTAAAGGCACACTATG -3'
(R):5'- TATGGCTTTGAGCTCCAGTCAGAAC -3'
Posted On2014-06-23