Incidental Mutation 'R1829:Ipcef1'
ID207128
Institutional Source Beutler Lab
Gene Symbol Ipcef1
Ensembl Gene ENSMUSG00000064065
Gene Nameinteraction protein for cytohesin exchange factors 1
Synonyms
MMRRC Submission 039856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1829 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location6885796-7052478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6919900 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 167 (A167T)
Ref Sequence ENSEMBL: ENSMUSP00000128131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052751] [ENSMUST00000063036] [ENSMUST00000078070] [ENSMUST00000086896] [ENSMUST00000105601] [ENSMUST00000105611] [ENSMUST00000105615] [ENSMUST00000105617] [ENSMUST00000123861] [ENSMUST00000129221] [ENSMUST00000129954] [ENSMUST00000170680] [ENSMUST00000145156] [ENSMUST00000147171] [ENSMUST00000154941] [ENSMUST00000135502] [ENSMUST00000144264]
Predicted Effect probably benign
Transcript: ENSMUST00000052751
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078070
AA Change: A218T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077215
Gene: ENSMUSG00000064065
AA Change: A218T

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 150 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
Blast:PH 286 343 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000086896
AA Change: A167T

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084110
Gene: ENSMUSG00000064065
AA Change: A167T

DomainStartEndE-ValueType
Pfam:PH 3 65 7.4e-8 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105601
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105611
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105615
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105617
AA Change: A214T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101242
Gene: ENSMUSG00000064065
AA Change: A214T

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 153 N/A INTRINSIC
low complexity region 242 257 N/A INTRINSIC
Blast:PH 282 339 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123861
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129221
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129954
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170680
AA Change: A167T

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128131
Gene: ENSMUSG00000064065
AA Change: A167T

DomainStartEndE-ValueType
Pfam:PH 3 65 7.4e-8 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145156
AA Change: A237T

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114267
Gene: ENSMUSG00000064065
AA Change: A237T

DomainStartEndE-ValueType
PH 37 137 5.87e-20 SMART
low complexity region 155 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154998
Predicted Effect probably benign
Transcript: ENSMUST00000147171
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154941
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135502
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144264
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T A 9: 98,903,393 I37N possibly damaging Het
Aars A T 8: 111,042,706 D287V probably damaging Het
Abca12 A G 1: 71,295,029 C1105R probably benign Het
Abca8b T A 11: 109,942,341 N1178Y probably damaging Het
Abhd12 A G 2: 150,843,398 L189P probably damaging Het
Acap2 G T 16: 31,110,934 N435K probably damaging Het
Adam6b G T 12: 113,489,925 G121C probably damaging Het
Adgrb1 C A 15: 74,580,586 C200* probably null Het
Agbl5 T C 5: 30,903,064 S730P possibly damaging Het
Ahsg G A 16: 22,892,328 probably benign Het
Aldh9a1 A T 1: 167,361,854 K390N probably benign Het
Alpk2 T A 18: 65,294,094 H1857L possibly damaging Het
Apip T A 2: 103,088,662 N102K probably benign Het
Asxl2 T C 12: 3,457,125 S106P probably damaging Het
Atp2b2 G T 6: 113,773,368 R677S probably damaging Het
Barhl1 A C 2: 28,909,845 M256R probably damaging Het
BC025446 T G 15: 75,216,756 probably null Het
BC052040 G T 2: 115,642,692 R101L possibly damaging Het
Cacnb2 A T 2: 14,985,964 Q619L possibly damaging Het
Ccdc137 C T 11: 120,458,212 P23L probably benign Het
Cdh11 A T 8: 102,634,641 N688K possibly damaging Het
Cdh18 C T 15: 23,173,852 P51S probably damaging Het
Cfhr1 A T 1: 139,553,600 Y181N probably damaging Het
Chmp3 A G 6: 71,560,939 D50G probably benign Het
Crem T C 18: 3,295,037 probably null Het
Cyb561a3 G A 19: 10,582,393 W27* probably null Het
Cyp2d12 C A 15: 82,558,056 N297K possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 T C 14: 26,773,023 L1346P probably damaging Het
Dnah12 T A 14: 26,800,075 N1948K probably damaging Het
Dsp T G 13: 38,193,195 L1652R probably damaging Het
Dstyk G A 1: 132,449,595 S66N probably benign Het
Ehhadh T C 16: 21,762,178 E688G probably damaging Het
Emsy T A 7: 98,602,729 H688L possibly damaging Het
Emsy G T 7: 98,602,730 H688N possibly damaging Het
Endod1 A G 9: 14,356,926 L421P probably damaging Het
Fam222b C T 11: 78,155,035 P346L probably damaging Het
Fam3c G A 6: 22,309,437 R182W probably damaging Het
Gck T C 11: 5,910,984 D29G probably damaging Het
Gm10320 C A 13: 98,489,699 R59L probably damaging Het
Gm11127 G T 17: 36,058,004 F61L probably damaging Het
Gm21798 C T 15: 64,817,826 probably benign Het
Gm9376 A G 14: 118,267,545 T130A possibly damaging Het
Gpr153 T A 4: 152,282,392 I334N possibly damaging Het
Greb1l T C 18: 10,509,314 L542P probably damaging Het
Hacl1 T C 14: 31,640,534 E52G probably benign Het
Ice2 A G 9: 69,407,353 Y128C probably damaging Het
Ikzf2 T A 1: 69,542,287 I121L probably benign Het
Jakmip2 T A 18: 43,582,080 D127V possibly damaging Het
Jph4 T C 14: 55,114,911 T122A probably damaging Het
Kcns2 A G 15: 34,838,803 E104G probably damaging Het
Lars2 A C 9: 123,431,917 R384S probably benign Het
Lsmem1 T A 12: 40,185,408 H3L possibly damaging Het
Lsmem1 G T 12: 40,185,409 H3N possibly damaging Het
Mfhas1 A C 8: 35,590,068 S566R probably benign Het
Mfhas1 C G 8: 35,590,248 R626G probably benign Het
Mgam A G 6: 40,666,892 T585A probably damaging Het
Mmp25 T C 17: 23,640,023 K185E probably benign Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Mtcp1 A T X: 75,411,665 Y25* probably null Het
Mybl2 A G 2: 163,059,583 T35A probably benign Het
Myh11 T C 16: 14,223,880 E736G probably damaging Het
Myh2 T C 11: 67,176,559 I224T probably damaging Het
Mymx T C 17: 45,601,833 probably benign Het
Nek10 A G 14: 14,863,454 probably null Het
Nsd1 A T 13: 55,246,369 K697N probably damaging Het
Nynrin A G 14: 55,872,947 D1837G possibly damaging Het
Olfr115 G A 17: 37,610,277 T158I probably benign Het
Olfr424 T A 1: 174,137,194 I150N probably benign Het
Olfr510 T A 7: 108,667,644 I76N probably benign Het
Olfr593 A T 7: 103,211,886 T9S probably benign Het
Olfr701 A G 7: 106,819,007 H308R probably benign Het
Phf19 T C 2: 34,911,769 T10A probably benign Het
Pkd1 A T 17: 24,565,584 H368L probably benign Het
Plscr2 A G 9: 92,290,755 R156G probably damaging Het
Ppp1r42 G A 1: 10,000,086 R61C probably benign Het
Pptc7 T G 5: 122,313,616 V45G probably damaging Het
Prlhr G A 19: 60,467,429 T233I probably damaging Het
Reps1 C T 10: 18,107,714 T435I probably damaging Het
Ret T A 6: 118,153,951 T1084S probably damaging Het
Rgl2 T A 17: 33,933,621 M402K probably benign Het
Rp2 A G X: 20,376,915 K43R probably benign Het
Rundc3b A T 5: 8,579,117 W95R probably damaging Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Scnn1b G A 7: 121,902,845 R242H probably benign Het
Smad4 G T 18: 73,641,894 Q445K probably benign Het
Smchd1 G T 17: 71,370,337 P1486T probably damaging Het
Snx25 G T 8: 46,035,632 N895K possibly damaging Het
Sox2 A G 3: 34,650,741 D109G probably damaging Het
Stfa2 A T 16: 36,405,202 N38K probably damaging Het
Stfa2 C A 16: 36,405,211 E35D possibly damaging Het
Stfa3 A G 16: 36,450,661 L87P probably damaging Het
Strbp T C 2: 37,640,909 D111G possibly damaging Het
Supt20 C A 3: 54,727,658 probably benign Het
Svep1 A G 4: 58,096,310 Y1437H possibly damaging Het
Tbx4 T A 11: 85,911,920 probably null Het
Tmem117 A T 15: 95,094,551 N364I probably damaging Het
Tmem8 T C 17: 26,122,220 Y766H probably damaging Het
Trat1 T C 16: 48,761,379 E45G probably damaging Het
Trpc2 G A 7: 102,084,119 D92N probably damaging Het
Trpm1 G A 7: 64,226,782 D528N probably damaging Het
Ttll9 A G 2: 153,000,236 S337G possibly damaging Het
Utrn A T 10: 12,475,274 I355N probably damaging Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn1r209 A G 13: 22,806,239 S94P possibly damaging Het
Vmn2r28 T A 7: 5,493,811 Q14L probably benign Het
Vps45 A G 3: 96,047,245 probably null Het
Wdr48 T C 9: 119,904,330 V81A probably benign Het
Xpnpep2 A G X: 48,125,353 N476S probably benign Het
Zbtb41 A T 1: 139,446,922 K707* probably null Het
Zfp442 A C 2: 150,409,063 C306W probably damaging Het
Zfp811 T C 17: 32,798,142 N307S possibly damaging Het
Zfp976 A G 7: 42,616,311 W17R probably damaging Het
Zyg11b T C 4: 108,266,093 T226A possibly damaging Het
Other mutations in Ipcef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Ipcef1 APN 10 6919968 missense probably damaging 1.00
IGL01018:Ipcef1 APN 10 6890551 missense probably benign
IGL01295:Ipcef1 APN 10 6900642 missense probably damaging 1.00
IGL01738:Ipcef1 APN 10 6890575 missense probably damaging 1.00
IGL03095:Ipcef1 APN 10 6919732 missense probably damaging 1.00
R0001:Ipcef1 UTSW 10 6900600 missense probably damaging 0.99
R0206:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R0208:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R1161:Ipcef1 UTSW 10 6980288 critical splice acceptor site probably null
R1496:Ipcef1 UTSW 10 6935173 critical splice donor site probably null
R1592:Ipcef1 UTSW 10 6935182 splice site probably null
R1893:Ipcef1 UTSW 10 6900680 missense probably damaging 1.00
R2107:Ipcef1 UTSW 10 6890501 missense probably benign 0.01
R2160:Ipcef1 UTSW 10 6890650 missense probably damaging 1.00
R2413:Ipcef1 UTSW 10 6935225 missense probably damaging 1.00
R2655:Ipcef1 UTSW 10 6979657 missense probably benign 0.02
R2886:Ipcef1 UTSW 10 6900641 missense probably damaging 1.00
R4752:Ipcef1 UTSW 10 6979573 missense probably damaging 1.00
R5134:Ipcef1 UTSW 10 6919950 missense probably benign 0.03
R5800:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
R5938:Ipcef1 UTSW 10 6908029 unclassified probably benign
R5989:Ipcef1 UTSW 10 6979532 nonsense probably null
R7397:Ipcef1 UTSW 10 6972244 makesense probably null
R7414:Ipcef1 UTSW 10 6890673 nonsense probably null
R7425:Ipcef1 UTSW 10 6956066 missense probably damaging 1.00
R7859:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
R7966:Ipcef1 UTSW 10 6900668 missense probably damaging 1.00
R8255:Ipcef1 UTSW 10 6920007 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAGTAAGCAAATTCCTGGTTTACCTC -3'
(R):5'- AAATAGGCTGCACAGTGGGC -3'

Sequencing Primer
(F):5'- GTCTGCCATTCTTGATCCAGCAG -3'
(R):5'- TGCACAGTGGGCATCTTC -3'
Posted On2014-06-23