Incidental Mutation 'R1829:Ipcef1'
ID207128
Institutional Source Beutler Lab
Gene Symbol Ipcef1
Ensembl Gene ENSMUSG00000064065
Gene Nameinteraction protein for cytohesin exchange factors 1
Synonyms
MMRRC Submission 039856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1829 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location6885796-7052478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6919900 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 167 (A167T)
Ref Sequence ENSEMBL: ENSMUSP00000128131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052751] [ENSMUST00000063036] [ENSMUST00000078070] [ENSMUST00000086896] [ENSMUST00000105601] [ENSMUST00000105611] [ENSMUST00000105615] [ENSMUST00000105617] [ENSMUST00000123861] [ENSMUST00000129221] [ENSMUST00000129954] [ENSMUST00000135502] [ENSMUST00000144264] [ENSMUST00000145156] [ENSMUST00000147171] [ENSMUST00000154941] [ENSMUST00000170680]
Predicted Effect probably benign
Transcript: ENSMUST00000052751
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078070
AA Change: A218T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077215
Gene: ENSMUSG00000064065
AA Change: A218T

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 150 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
Blast:PH 286 343 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000086896
AA Change: A167T

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084110
Gene: ENSMUSG00000064065
AA Change: A167T

DomainStartEndE-ValueType
Pfam:PH 3 65 7.4e-8 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105601
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105611
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105615
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105617
AA Change: A214T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101242
Gene: ENSMUSG00000064065
AA Change: A214T

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 153 N/A INTRINSIC
low complexity region 242 257 N/A INTRINSIC
Blast:PH 282 339 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123861
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129221
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129954
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135502
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect probably benign
Transcript: ENSMUST00000144264
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144622
Predicted Effect probably benign
Transcript: ENSMUST00000145156
AA Change: A237T

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114267
Gene: ENSMUSG00000064065
AA Change: A237T

DomainStartEndE-ValueType
PH 37 137 5.87e-20 SMART
low complexity region 155 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147171
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149708
Predicted Effect probably benign
Transcript: ENSMUST00000154941
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154998
Predicted Effect probably benign
Transcript: ENSMUST00000170680
AA Change: A167T

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128131
Gene: ENSMUSG00000064065
AA Change: A167T

DomainStartEndE-ValueType
Pfam:PH 3 65 7.4e-8 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype Homozygotes for null mutations exhibit isoform dependent loss of behavioral and gastrointestinal opioid responses and may also show impaired spatial memory, heightened nociception, reduced locomotor activity, increased hematopoietic proliferation, and decreased male fertility.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T A 9: 98,903,393 I37N possibly damaging Het
Aars A T 8: 111,042,706 D287V probably damaging Het
Abca12 A G 1: 71,295,029 C1105R probably benign Het
Abca8b T A 11: 109,942,341 N1178Y probably damaging Het
Abhd12 A G 2: 150,843,398 L189P probably damaging Het
Acap2 G T 16: 31,110,934 N435K probably damaging Het
Adam6b G T 12: 113,489,925 G121C probably damaging Het
Adgrb1 C A 15: 74,580,586 C200* probably null Het
Agbl5 T C 5: 30,903,064 S730P possibly damaging Het
Ahsg G A 16: 22,892,328 probably benign Het
Aldh9a1 A T 1: 167,361,854 K390N probably benign Het
Alpk2 T A 18: 65,294,094 H1857L possibly damaging Het
Apip T A 2: 103,088,662 N102K probably benign Het
Asxl2 T C 12: 3,457,125 S106P probably damaging Het
Atp2b2 G T 6: 113,773,368 R677S probably damaging Het
Barhl1 A C 2: 28,909,845 M256R probably damaging Het
BC025446 T G 15: 75,216,756 probably null Het
BC052040 G T 2: 115,642,692 R101L possibly damaging Het
Cacnb2 A T 2: 14,985,964 Q619L possibly damaging Het
Ccdc137 C T 11: 120,458,212 P23L probably benign Het
Cdh11 A T 8: 102,634,641 N688K possibly damaging Het
Cdh18 C T 15: 23,173,852 P51S probably damaging Het
Cfhr1 A T 1: 139,553,600 Y181N probably damaging Het
Chmp3 A G 6: 71,560,939 D50G probably benign Het
Crem T C 18: 3,295,037 probably null Het
Cyb561a3 G A 19: 10,582,393 W27* probably null Het
Cyp2d12 C A 15: 82,558,056 N297K possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 T C 14: 26,773,023 L1346P probably damaging Het
Dnah12 T A 14: 26,800,075 N1948K probably damaging Het
Dsp T G 13: 38,193,195 L1652R probably damaging Het
Dstyk G A 1: 132,449,595 S66N probably benign Het
Ehhadh T C 16: 21,762,178 E688G probably damaging Het
Emsy T A 7: 98,602,729 H688L possibly damaging Het
Emsy G T 7: 98,602,730 H688N possibly damaging Het
Endod1 A G 9: 14,356,926 L421P probably damaging Het
Fam222b C T 11: 78,155,035 P346L probably damaging Het
Fam3c G A 6: 22,309,437 R182W probably damaging Het
Gck T C 11: 5,910,984 D29G probably damaging Het
Gm10320 C A 13: 98,489,699 R59L probably damaging Het
Gm11127 G T 17: 36,058,004 F61L probably damaging Het
Gm21798 C T 15: 64,817,826 probably benign Het
Gm9376 A G 14: 118,267,545 T130A possibly damaging Het
Gpr153 T A 4: 152,282,392 I334N possibly damaging Het
Greb1l T C 18: 10,509,314 L542P probably damaging Het
Hacl1 T C 14: 31,640,534 E52G probably benign Het
Ice2 A G 9: 69,407,353 Y128C probably damaging Het
Ikzf2 T A 1: 69,542,287 I121L probably benign Het
Jakmip2 T A 18: 43,582,080 D127V possibly damaging Het
Jph4 T C 14: 55,114,911 T122A probably damaging Het
Kcns2 A G 15: 34,838,803 E104G probably damaging Het
Lars2 A C 9: 123,431,917 R384S probably benign Het
Lsmem1 T A 12: 40,185,408 H3L possibly damaging Het
Lsmem1 G T 12: 40,185,409 H3N possibly damaging Het
Mfhas1 A C 8: 35,590,068 S566R probably benign Het
Mfhas1 C G 8: 35,590,248 R626G probably benign Het
Mgam A G 6: 40,666,892 T585A probably damaging Het
Mmp25 T C 17: 23,640,023 K185E probably benign Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Mtcp1 A T X: 75,411,665 Y25* probably null Het
Mybl2 A G 2: 163,059,583 T35A probably benign Het
Myh11 T C 16: 14,223,880 E736G probably damaging Het
Myh2 T C 11: 67,176,559 I224T probably damaging Het
Mymx T C 17: 45,601,833 probably benign Het
Nek10 A G 14: 14,863,454 probably null Het
Nsd1 A T 13: 55,246,369 K697N probably damaging Het
Nynrin A G 14: 55,872,947 D1837G possibly damaging Het
Olfr115 G A 17: 37,610,277 T158I probably benign Het
Olfr424 T A 1: 174,137,194 I150N probably benign Het
Olfr510 T A 7: 108,667,644 I76N probably benign Het
Olfr593 A T 7: 103,211,886 T9S probably benign Het
Olfr701 A G 7: 106,819,007 H308R probably benign Het
Phf19 T C 2: 34,911,769 T10A probably benign Het
Pkd1 A T 17: 24,565,584 H368L probably benign Het
Plscr2 A G 9: 92,290,755 R156G probably damaging Het
Ppp1r42 G A 1: 10,000,086 R61C probably benign Het
Pptc7 T G 5: 122,313,616 V45G probably damaging Het
Prlhr G A 19: 60,467,429 T233I probably damaging Het
Reps1 C T 10: 18,107,714 T435I probably damaging Het
Ret T A 6: 118,153,951 T1084S probably damaging Het
Rgl2 T A 17: 33,933,621 M402K probably benign Het
Rp2 A G X: 20,376,915 K43R probably benign Het
Rundc3b A T 5: 8,579,117 W95R probably damaging Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Scnn1b G A 7: 121,902,845 R242H probably benign Het
Smad4 G T 18: 73,641,894 Q445K probably benign Het
Smchd1 G T 17: 71,370,337 P1486T probably damaging Het
Snx25 G T 8: 46,035,632 N895K possibly damaging Het
Sox2 A G 3: 34,650,741 D109G probably damaging Het
Stfa2 A T 16: 36,405,202 N38K probably damaging Het
Stfa2 C A 16: 36,405,211 E35D possibly damaging Het
Stfa3 A G 16: 36,450,661 L87P probably damaging Het
Strbp T C 2: 37,640,909 D111G possibly damaging Het
Supt20 C A 3: 54,727,658 probably benign Het
Svep1 A G 4: 58,096,310 Y1437H possibly damaging Het
Tbx4 T A 11: 85,911,920 probably null Het
Tmem117 A T 15: 95,094,551 N364I probably damaging Het
Tmem8 T C 17: 26,122,220 Y766H probably damaging Het
Trat1 T C 16: 48,761,379 E45G probably damaging Het
Trpc2 G A 7: 102,084,119 D92N probably damaging Het
Trpm1 G A 7: 64,226,782 D528N probably damaging Het
Ttll9 A G 2: 153,000,236 S337G possibly damaging Het
Utrn A T 10: 12,475,274 I355N probably damaging Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn1r209 A G 13: 22,806,239 S94P possibly damaging Het
Vmn2r28 T A 7: 5,493,811 Q14L probably benign Het
Vps45 A G 3: 96,047,245 probably null Het
Wdr48 T C 9: 119,904,330 V81A probably benign Het
Xpnpep2 A G X: 48,125,353 N476S probably benign Het
Zbtb41 A T 1: 139,446,922 K707* probably null Het
Zfp442 A C 2: 150,409,063 C306W probably damaging Het
Zfp811 T C 17: 32,798,142 N307S possibly damaging Het
Zfp976 A G 7: 42,616,311 W17R probably damaging Het
Zyg11b T C 4: 108,266,093 T226A possibly damaging Het
Other mutations in Ipcef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Ipcef1 APN 10 6919968 missense probably damaging 1.00
IGL01018:Ipcef1 APN 10 6890551 missense probably benign
IGL01295:Ipcef1 APN 10 6900642 missense probably damaging 1.00
IGL01738:Ipcef1 APN 10 6890575 missense probably damaging 1.00
IGL03095:Ipcef1 APN 10 6919732 missense probably damaging 1.00
R0001:Ipcef1 UTSW 10 6900600 missense probably damaging 0.99
R0206:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R0208:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R1161:Ipcef1 UTSW 10 6980288 critical splice acceptor site probably null
R1496:Ipcef1 UTSW 10 6935173 critical splice donor site probably null
R1592:Ipcef1 UTSW 10 6935182 splice site probably null
R1893:Ipcef1 UTSW 10 6900680 missense probably damaging 1.00
R2107:Ipcef1 UTSW 10 6890501 missense probably benign 0.01
R2160:Ipcef1 UTSW 10 6890650 missense probably damaging 1.00
R2413:Ipcef1 UTSW 10 6935225 missense probably damaging 1.00
R2655:Ipcef1 UTSW 10 6979657 missense probably benign 0.02
R2886:Ipcef1 UTSW 10 6900641 missense probably damaging 1.00
R4752:Ipcef1 UTSW 10 6979573 missense probably damaging 1.00
R5134:Ipcef1 UTSW 10 6919950 missense probably benign 0.03
R5800:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
R5938:Ipcef1 UTSW 10 6908029 unclassified probably benign
R5989:Ipcef1 UTSW 10 6979532 nonsense probably null
R7397:Ipcef1 UTSW 10 6972244 makesense probably null
R7414:Ipcef1 UTSW 10 6890673 nonsense probably null
R7425:Ipcef1 UTSW 10 6956066 missense probably damaging 1.00
R7859:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
R7942:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTAAGCAAATTCCTGGTTTACCTC -3'
(R):5'- AAATAGGCTGCACAGTGGGC -3'

Sequencing Primer
(F):5'- GTCTGCCATTCTTGATCCAGCAG -3'
(R):5'- TGCACAGTGGGCATCTTC -3'
Posted On2014-06-23