Incidental Mutation 'R0115:Hectd4'
ID 20713
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene Name HECT domain E3 ubiquitin protein ligase 4
Synonyms Gm15800
MMRRC Submission 038401-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.923) question?
Stock # R0115 (G1)
Quality Score 220
Status Validated (trace)
Chromosome 5
Chromosomal Location 121220219-121368577 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 121295506 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042614
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128514
Predicted Effect probably benign
Transcript: ENSMUST00000148368
Predicted Effect probably benign
Transcript: ENSMUST00000201669
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,594,142 probably benign Het
2310007B03Rik A T 1: 93,159,725 S135R possibly damaging Het
4921528I07Rik A G 9: 114,279,384 noncoding transcript Het
Alas1 A T 9: 106,238,252 probably null Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
Arhgap20 T A 9: 51,838,972 I344N probably damaging Het
Arhgap30 A C 1: 171,407,948 E630A possibly damaging Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bysl C T 17: 47,610,942 R77Q probably benign Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccdc146 T C 5: 21,322,756 I187M possibly damaging Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Ces5a A T 8: 93,502,183 M473K probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Cyp2c50 T A 19: 40,092,393 probably benign Het
Dlg1 C A 16: 31,805,690 Y399* probably null Het
Drosha A T 15: 12,846,130 E92D probably benign Het
Fanca C T 8: 123,268,539 G1408D probably benign Het
Frem1 T A 4: 82,936,169 D1621V possibly damaging Het
Frem2 G A 3: 53,656,208 R293C probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Glipr1 A G 10: 111,993,541 I105T probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Gm281 A G 14: 13,899,571 V117A probably damaging Het
Gon4l T A 3: 88,895,682 V1200D probably damaging Het
Gpc1 G A 1: 92,857,499 D387N probably damaging Het
Gsdmc A G 15: 63,803,637 Y110H probably damaging Het
Gucy1b1 T A 3: 82,034,391 H586L probably benign Het
Gucy2e A G 11: 69,236,632 L5P unknown Het
Hmcn1 T A 1: 150,808,647 I391F possibly damaging Het
Hsf4 A T 8: 105,272,704 probably null Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnma1 C A 14: 23,314,175 R980L probably damaging Het
Kif1a A G 1: 93,046,778 probably benign Het
Klhdc7b A G 15: 89,388,521 H1202R probably benign Het
Lig3 A G 11: 82,793,935 D559G probably damaging Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
March6 A T 15: 31,475,812 F633I probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Megf10 G T 18: 57,259,802 V424L possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mut C T 17: 40,956,227 T564M probably damaging Het
Myh8 A G 11: 67,306,264 probably benign Het
Mypn T C 10: 63,192,380 probably benign Het
Nf1 G A 11: 79,468,876 probably null Het
Notch3 T A 17: 32,133,462 T1866S possibly damaging Het
Olfr108 C T 17: 37,445,779 A86V probably benign Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr390 A G 11: 73,787,315 I126V possibly damaging Het
Pkhd1 A T 1: 20,350,490 I2464N probably damaging Het
Pkn1 A G 8: 83,671,029 S817P probably damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Psmd1 C T 1: 86,083,271 T356I possibly damaging Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rbm42 G A 7: 30,647,775 T106I probably damaging Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rorc T C 3: 94,377,609 probably benign Het
Rpl22l1 T C 3: 28,806,536 F15L probably damaging Het
Slc6a20a C A 9: 123,678,758 A17S possibly damaging Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Sp100 A G 1: 85,650,131 probably benign Het
Ssc5d G A 7: 4,927,881 probably benign Het
Taf11 A G 17: 27,907,661 L4P probably benign Het
Tm2d3 A G 7: 65,695,334 probably benign Het
Tmub2 T C 11: 102,288,375 probably null Het
Trim34a T A 7: 104,247,902 C58S probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r74 T C 7: 85,957,356 M261V probably benign Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Wdr95 A T 5: 149,564,390 D163V probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Ythdc2 C T 18: 44,841,423 probably benign Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
Achilles UTSW 5 121307381 nonsense probably null
agamemnon UTSW 5 121253858 splice site probably benign
clymnestra UTSW 5 121334375 missense possibly damaging 0.86
hector UTSW 5 121315437 missense probably damaging 1.00
helen UTSW 5 121310663 missense probably damaging 0.97
Merriwether UTSW 5 121353551 missense possibly damaging 0.53
PIT4466001:Hectd4 UTSW 5 121333060 critical splice donor site probably null
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 splice site probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 splice site probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121273629 missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121308342 missense probably benign 0.01
R7234:Hectd4 UTSW 5 121329073 missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121314881 missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121310663 missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121281932 missense probably benign 0.00
R7467:Hectd4 UTSW 5 121323961 missense possibly damaging 0.66
R7475:Hectd4 UTSW 5 121358133 splice site probably null
R7482:Hectd4 UTSW 5 121363878 missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121297109 missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121343665 missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121315510 splice site probably null
R7560:Hectd4 UTSW 5 121254342 missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121291225 missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121349459 missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121318735 missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121254371 missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121324031 missense probably benign 0.06
R7692:Hectd4 UTSW 5 121321564 missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121220617 missense unknown
R7731:Hectd4 UTSW 5 121307014 missense probably benign 0.00
R7732:Hectd4 UTSW 5 121336629 missense probably benign 0.14
R7782:Hectd4 UTSW 5 121305721 missense possibly damaging 0.53
R7854:Hectd4 UTSW 5 121329568 missense probably benign 0.27
R7898:Hectd4 UTSW 5 121331817 missense probably benign 0.18
R7910:Hectd4 UTSW 5 121254228 missense possibly damaging 0.86
R7962:Hectd4 UTSW 5 121310629 missense probably damaging 0.98
R8003:Hectd4 UTSW 5 121339518 missense possibly damaging 0.85
R8098:Hectd4 UTSW 5 121321398 missense possibly damaging 0.46
R8110:Hectd4 UTSW 5 121332949 missense possibly damaging 0.96
R8118:Hectd4 UTSW 5 121286376 missense probably benign 0.33
R8171:Hectd4 UTSW 5 121318756 missense possibly damaging 0.82
R8234:Hectd4 UTSW 5 121339544 missense possibly damaging 0.72
R8289:Hectd4 UTSW 5 121266361 missense possibly damaging 0.53
R8292:Hectd4 UTSW 5 121317225 missense possibly damaging 0.66
R8348:Hectd4 UTSW 5 121220256 start gained probably benign
R8397:Hectd4 UTSW 5 121259894 missense probably damaging 0.98
R8436:Hectd4 UTSW 5 121308358 missense possibly damaging 0.90
R8436:Hectd4 UTSW 5 121343147 missense probably benign 0.00
R8443:Hectd4 UTSW 5 121329109 missense possibly damaging 0.72
R8448:Hectd4 UTSW 5 121220256 start gained probably benign
R8516:Hectd4 UTSW 5 121349010 missense possibly damaging 0.53
R8519:Hectd4 UTSW 5 121304426 nonsense probably null
R8553:Hectd4 UTSW 5 121353598 missense possibly damaging 0.73
R8557:Hectd4 UTSW 5 121310651 missense possibly damaging 0.66
R8725:Hectd4 UTSW 5 121350494 missense probably damaging 1.00
R8751:Hectd4 UTSW 5 121363775 nonsense probably null
R8769:Hectd4 UTSW 5 121281873 missense possibly damaging 0.53
R8803:Hectd4 UTSW 5 121323931 missense probably benign 0.01
R8887:Hectd4 UTSW 5 121295478 missense probably benign 0.44
R8982:Hectd4 UTSW 5 121328242 missense probably benign 0.02
R8988:Hectd4 UTSW 5 121277756 missense possibly damaging 0.86
R8991:Hectd4 UTSW 5 121358284 missense probably benign 0.33
R8994:Hectd4 UTSW 5 121303566 missense probably benign 0.33
R8995:Hectd4 UTSW 5 121254359 missense possibly damaging 0.96
R9049:Hectd4 UTSW 5 121313892 missense possibly damaging 0.92
R9093:Hectd4 UTSW 5 121273614 missense probably benign 0.14
R9106:Hectd4 UTSW 5 121329556 missense possibly damaging 0.53
R9137:Hectd4 UTSW 5 121358175 missense possibly damaging 0.53
R9146:Hectd4 UTSW 5 121349034 missense probably benign 0.33
R9154:Hectd4 UTSW 5 121253904 missense
R9162:Hectd4 UTSW 5 121306979 missense possibly damaging 0.66
R9166:Hectd4 UTSW 5 121308627 missense probably damaging 0.96
R9183:Hectd4 UTSW 5 121299488 missense possibly damaging 0.51
R9207:Hectd4 UTSW 5 121295433 missense possibly damaging 0.86
R9291:Hectd4 UTSW 5 121348965 missense probably benign 0.14
R9300:Hectd4 UTSW 5 121348889 missense probably benign 0.33
R9314:Hectd4 UTSW 5 121299645 critical splice donor site probably null
R9381:Hectd4 UTSW 5 121334429 missense possibly damaging 0.53
R9432:Hectd4 UTSW 5 121322801 missense probably benign 0.01
R9491:Hectd4 UTSW 5 121314918 missense probably damaging 0.97
R9532:Hectd4 UTSW 5 121364553 missense probably benign 0.00
R9557:Hectd4 UTSW 5 121321554 missense possibly damaging 0.66
R9561:Hectd4 UTSW 5 121334469 missense possibly damaging 0.53
R9593:Hectd4 UTSW 5 121286781 nonsense probably null
R9704:Hectd4 UTSW 5 121310681 missense probably benign 0.00
R9705:Hectd4 UTSW 5 121310681 missense probably benign 0.00
R9712:Hectd4 UTSW 5 121310681 missense probably benign 0.00
R9713:Hectd4 UTSW 5 121310681 missense probably benign 0.00
R9726:Hectd4 UTSW 5 121310681 missense probably benign 0.00
R9732:Hectd4 UTSW 5 121254191 nonsense probably null
R9750:Hectd4 UTSW 5 121310681 missense probably benign 0.00
R9752:Hectd4 UTSW 5 121310681 missense probably benign 0.00
R9752:Hectd4 UTSW 5 121334352 missense possibly damaging 0.85
R9772:Hectd4 UTSW 5 121310681 missense probably benign 0.00
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Z1177:Hectd4 UTSW 5 121358320 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCACTGCACTGAGTTTCTACTGG -3'
(R):5'- TCGTCACAGCACTAAGGCAAATGG -3'

Sequencing Primer
(F):5'- GTGCATTACTCATCACAAGACTGG -3'
(R):5'- tgggaggcagaggcaag -3'
Posted On 2013-04-11