Incidental Mutation 'R1829:Reps1'
ID207130
Institutional Source Beutler Lab
Gene Symbol Reps1
Ensembl Gene ENSMUSG00000019854
Gene NameRalBP1 associated Eps domain containing protein
Synonyms
MMRRC Submission 039856-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock #R1829 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location18055861-18125155 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18107714 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 435 (T435I)
Ref Sequence ENSEMBL: ENSMUSP00000123238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126390] [ENSMUST00000154718] [ENSMUST00000155284] [ENSMUST00000164556]
PDB Structure
SOLUTION STRUCTURE OF THE REPS1 EH DOMAIN [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000126390
AA Change: T435I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123238
Gene: ENSMUSG00000019854
AA Change: T435I

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 545 561 N/A INTRINSIC
low complexity region 574 599 N/A INTRINSIC
Blast:MYSc 613 671 1e-15 BLAST
coiled coil region 750 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128711
Predicted Effect probably benign
Transcript: ENSMUST00000150029
SMART Domains Protein: ENSMUSP00000119651
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
Blast:EH 2 86 5e-51 BLAST
low complexity region 143 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 241 252 N/A INTRINSIC
EH 265 360 2.18e-34 SMART
low complexity region 377 393 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 534 559 N/A INTRINSIC
Blast:MYSc 573 631 1e-15 BLAST
coiled coil region 709 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154718
SMART Domains Protein: ENSMUSP00000119358
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 484 509 N/A INTRINSIC
Blast:MYSc 523 581 9e-16 BLAST
coiled coil region 660 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155284
SMART Domains Protein: ENSMUSP00000119629
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
Blast:EH 3 99 6e-65 BLAST
low complexity region 156 175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155892
AA Change: T142I
SMART Domains Protein: ENSMUSP00000117431
Gene: ENSMUSG00000019854
AA Change: T142I

DomainStartEndE-ValueType
EH 2 82 9.44e-21 SMART
low complexity region 99 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155959
SMART Domains Protein: ENSMUSP00000114387
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
EH 99 194 2.18e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164556
SMART Domains Protein: ENSMUSP00000130501
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
low complexity region 547 572 N/A INTRINSIC
Blast:MYSc 586 644 9e-16 BLAST
coiled coil region 723 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216576
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a signaling adaptor protein with two EH domains that interacts with proteins that participate in signaling, endocytosis and cytoskeletal changes. The encoded protein has been found in association with intersectin 1 and Src homology 3-domain growth factor receptor-bound 2-like (endophilin) interacting protein 1 when intersectin 1 was isolated from clathrin-coated pits. The encoded protein has also been shown to interact with amphiphysin, a cytoplasmic protein at the surface of synaptic vesicles. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T A 9: 98,903,393 I37N possibly damaging Het
Aars A T 8: 111,042,706 D287V probably damaging Het
Abca12 A G 1: 71,295,029 C1105R probably benign Het
Abca8b T A 11: 109,942,341 N1178Y probably damaging Het
Abhd12 A G 2: 150,843,398 L189P probably damaging Het
Acap2 G T 16: 31,110,934 N435K probably damaging Het
Adam6b G T 12: 113,489,925 G121C probably damaging Het
Adgrb1 C A 15: 74,580,586 C200* probably null Het
Agbl5 T C 5: 30,903,064 S730P possibly damaging Het
Ahsg G A 16: 22,892,328 probably benign Het
Aldh9a1 A T 1: 167,361,854 K390N probably benign Het
Alpk2 T A 18: 65,294,094 H1857L possibly damaging Het
Apip T A 2: 103,088,662 N102K probably benign Het
Asxl2 T C 12: 3,457,125 S106P probably damaging Het
Atp2b2 G T 6: 113,773,368 R677S probably damaging Het
Barhl1 A C 2: 28,909,845 M256R probably damaging Het
BC025446 T G 15: 75,216,756 probably null Het
BC052040 G T 2: 115,642,692 R101L possibly damaging Het
Cacnb2 A T 2: 14,985,964 Q619L possibly damaging Het
Ccdc137 C T 11: 120,458,212 P23L probably benign Het
Cdh11 A T 8: 102,634,641 N688K possibly damaging Het
Cdh18 C T 15: 23,173,852 P51S probably damaging Het
Cfhr1 A T 1: 139,553,600 Y181N probably damaging Het
Chmp3 A G 6: 71,560,939 D50G probably benign Het
Crem T C 18: 3,295,037 probably null Het
Cyb561a3 G A 19: 10,582,393 W27* probably null Het
Cyp2d12 C A 15: 82,558,056 N297K possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 T C 14: 26,773,023 L1346P probably damaging Het
Dnah12 T A 14: 26,800,075 N1948K probably damaging Het
Dsp T G 13: 38,193,195 L1652R probably damaging Het
Dstyk G A 1: 132,449,595 S66N probably benign Het
Ehhadh T C 16: 21,762,178 E688G probably damaging Het
Emsy T A 7: 98,602,729 H688L possibly damaging Het
Emsy G T 7: 98,602,730 H688N possibly damaging Het
Endod1 A G 9: 14,356,926 L421P probably damaging Het
Fam222b C T 11: 78,155,035 P346L probably damaging Het
Fam3c G A 6: 22,309,437 R182W probably damaging Het
Gck T C 11: 5,910,984 D29G probably damaging Het
Gm10320 C A 13: 98,489,699 R59L probably damaging Het
Gm11127 G T 17: 36,058,004 F61L probably damaging Het
Gm21798 C T 15: 64,817,826 probably benign Het
Gm9376 A G 14: 118,267,545 T130A possibly damaging Het
Gpr153 T A 4: 152,282,392 I334N possibly damaging Het
Greb1l T C 18: 10,509,314 L542P probably damaging Het
Hacl1 T C 14: 31,640,534 E52G probably benign Het
Ice2 A G 9: 69,407,353 Y128C probably damaging Het
Ikzf2 T A 1: 69,542,287 I121L probably benign Het
Ipcef1 C T 10: 6,919,900 A167T probably benign Het
Jakmip2 T A 18: 43,582,080 D127V possibly damaging Het
Jph4 T C 14: 55,114,911 T122A probably damaging Het
Kcns2 A G 15: 34,838,803 E104G probably damaging Het
Lars2 A C 9: 123,431,917 R384S probably benign Het
Lsmem1 T A 12: 40,185,408 H3L possibly damaging Het
Lsmem1 G T 12: 40,185,409 H3N possibly damaging Het
Mfhas1 A C 8: 35,590,068 S566R probably benign Het
Mfhas1 C G 8: 35,590,248 R626G probably benign Het
Mgam A G 6: 40,666,892 T585A probably damaging Het
Mmp25 T C 17: 23,640,023 K185E probably benign Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Mtcp1 A T X: 75,411,665 Y25* probably null Het
Mybl2 A G 2: 163,059,583 T35A probably benign Het
Myh11 T C 16: 14,223,880 E736G probably damaging Het
Myh2 T C 11: 67,176,559 I224T probably damaging Het
Mymx T C 17: 45,601,833 probably benign Het
Nek10 A G 14: 14,863,454 probably null Het
Nsd1 A T 13: 55,246,369 K697N probably damaging Het
Nynrin A G 14: 55,872,947 D1837G possibly damaging Het
Olfr115 G A 17: 37,610,277 T158I probably benign Het
Olfr424 T A 1: 174,137,194 I150N probably benign Het
Olfr510 T A 7: 108,667,644 I76N probably benign Het
Olfr593 A T 7: 103,211,886 T9S probably benign Het
Olfr701 A G 7: 106,819,007 H308R probably benign Het
Phf19 T C 2: 34,911,769 T10A probably benign Het
Pkd1 A T 17: 24,565,584 H368L probably benign Het
Plscr2 A G 9: 92,290,755 R156G probably damaging Het
Ppp1r42 G A 1: 10,000,086 R61C probably benign Het
Pptc7 T G 5: 122,313,616 V45G probably damaging Het
Prlhr G A 19: 60,467,429 T233I probably damaging Het
Ret T A 6: 118,153,951 T1084S probably damaging Het
Rgl2 T A 17: 33,933,621 M402K probably benign Het
Rp2 A G X: 20,376,915 K43R probably benign Het
Rundc3b A T 5: 8,579,117 W95R probably damaging Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Scnn1b G A 7: 121,902,845 R242H probably benign Het
Smad4 G T 18: 73,641,894 Q445K probably benign Het
Smchd1 G T 17: 71,370,337 P1486T probably damaging Het
Snx25 G T 8: 46,035,632 N895K possibly damaging Het
Sox2 A G 3: 34,650,741 D109G probably damaging Het
Stfa2 A T 16: 36,405,202 N38K probably damaging Het
Stfa2 C A 16: 36,405,211 E35D possibly damaging Het
Stfa3 A G 16: 36,450,661 L87P probably damaging Het
Strbp T C 2: 37,640,909 D111G possibly damaging Het
Supt20 C A 3: 54,727,658 probably benign Het
Svep1 A G 4: 58,096,310 Y1437H possibly damaging Het
Tbx4 T A 11: 85,911,920 probably null Het
Tmem117 A T 15: 95,094,551 N364I probably damaging Het
Tmem8 T C 17: 26,122,220 Y766H probably damaging Het
Trat1 T C 16: 48,761,379 E45G probably damaging Het
Trpc2 G A 7: 102,084,119 D92N probably damaging Het
Trpm1 G A 7: 64,226,782 D528N probably damaging Het
Ttll9 A G 2: 153,000,236 S337G possibly damaging Het
Utrn A T 10: 12,475,274 I355N probably damaging Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn1r209 A G 13: 22,806,239 S94P possibly damaging Het
Vmn2r28 T A 7: 5,493,811 Q14L probably benign Het
Vps45 A G 3: 96,047,245 probably null Het
Wdr48 T C 9: 119,904,330 V81A probably benign Het
Xpnpep2 A G X: 48,125,353 N476S probably benign Het
Zbtb41 A T 1: 139,446,922 K707* probably null Het
Zfp442 A C 2: 150,409,063 C306W probably damaging Het
Zfp811 T C 17: 32,798,142 N307S possibly damaging Het
Zfp976 A G 7: 42,616,311 W17R probably damaging Het
Zyg11b T C 4: 108,266,093 T226A possibly damaging Het
Other mutations in Reps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Reps1 APN 10 18124895 missense probably damaging 1.00
IGL01161:Reps1 APN 10 18093895 missense probably damaging 1.00
IGL01606:Reps1 APN 10 18107687 missense probably damaging 1.00
IGL01937:Reps1 APN 10 18093836 missense probably benign 0.04
IGL01945:Reps1 APN 10 18093836 missense probably benign 0.04
IGL02208:Reps1 APN 10 18119022 missense probably damaging 1.00
IGL02335:Reps1 APN 10 18056117 critical splice donor site probably null
IGL02706:Reps1 APN 10 18123015 splice site probably benign
IGL02747:Reps1 APN 10 18123600 missense probably damaging 1.00
R0554:Reps1 UTSW 10 18123119 missense possibly damaging 0.71
R0628:Reps1 UTSW 10 18121093 missense probably damaging 1.00
R1074:Reps1 UTSW 10 18094446 missense probably benign 0.01
R1710:Reps1 UTSW 10 18118950 missense possibly damaging 0.75
R2116:Reps1 UTSW 10 18124920 missense probably damaging 1.00
R2146:Reps1 UTSW 10 18093313 missense probably benign
R2161:Reps1 UTSW 10 18096283 missense probably damaging 0.99
R3704:Reps1 UTSW 10 18107680 missense probably damaging 1.00
R4115:Reps1 UTSW 10 18104207 missense possibly damaging 0.93
R4654:Reps1 UTSW 10 18114400 missense probably damaging 1.00
R4856:Reps1 UTSW 10 18123625 missense probably damaging 1.00
R4910:Reps1 UTSW 10 18107688 missense probably damaging 1.00
R5127:Reps1 UTSW 10 18093880 missense probably benign
R5521:Reps1 UTSW 10 18104234 missense probably damaging 1.00
R5707:Reps1 UTSW 10 18056010 missense probably benign 0.06
R5724:Reps1 UTSW 10 18114483 missense possibly damaging 0.75
R6564:Reps1 UTSW 10 18122392 intron probably null
R6996:Reps1 UTSW 10 18093855 missense probably damaging 1.00
R7026:Reps1 UTSW 10 18107689 missense probably damaging 1.00
R7423:Reps1 UTSW 10 18093887 missense possibly damaging 0.81
X0062:Reps1 UTSW 10 18104226 missense probably damaging 0.99
Z1176:Reps1 UTSW 10 18123125 missense probably damaging 0.99
Z1177:Reps1 UTSW 10 18093779 missense probably benign 0.05
Z1177:Reps1 UTSW 10 18124924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAATTTTGTCGATCCTGCG -3'
(R):5'- TGGCTAACCAGATCGACTATCAC -3'

Sequencing Primer
(F):5'- TGTCGATCCTGCGAAATGC -3'
(R):5'- GAATGGCAAAAATGTTCTTCCAC -3'
Posted On2014-06-23