Incidental Mutation 'R1829:Myh2'
ID207133
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 039856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R1829 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67176559 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 224 (I224T)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably damaging
Transcript: ENSMUST00000018641
AA Change: I224T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: I224T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124337
Predicted Effect probably damaging
Transcript: ENSMUST00000170159
AA Change: I224T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: I224T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T A 9: 98,903,393 I37N possibly damaging Het
Aars A T 8: 111,042,706 D287V probably damaging Het
Abca12 A G 1: 71,295,029 C1105R probably benign Het
Abca8b T A 11: 109,942,341 N1178Y probably damaging Het
Abhd12 A G 2: 150,843,398 L189P probably damaging Het
Acap2 G T 16: 31,110,934 N435K probably damaging Het
Adam6b G T 12: 113,489,925 G121C probably damaging Het
Adgrb1 C A 15: 74,580,586 C200* probably null Het
Agbl5 T C 5: 30,903,064 S730P possibly damaging Het
Ahsg G A 16: 22,892,328 probably benign Het
Aldh9a1 A T 1: 167,361,854 K390N probably benign Het
Alpk2 T A 18: 65,294,094 H1857L possibly damaging Het
Apip T A 2: 103,088,662 N102K probably benign Het
Asxl2 T C 12: 3,457,125 S106P probably damaging Het
Atp2b2 G T 6: 113,773,368 R677S probably damaging Het
Barhl1 A C 2: 28,909,845 M256R probably damaging Het
BC025446 T G 15: 75,216,756 probably null Het
BC052040 G T 2: 115,642,692 R101L possibly damaging Het
Cacnb2 A T 2: 14,985,964 Q619L possibly damaging Het
Ccdc137 C T 11: 120,458,212 P23L probably benign Het
Cdh11 A T 8: 102,634,641 N688K possibly damaging Het
Cdh18 C T 15: 23,173,852 P51S probably damaging Het
Cfhr1 A T 1: 139,553,600 Y181N probably damaging Het
Chmp3 A G 6: 71,560,939 D50G probably benign Het
Crem T C 18: 3,295,037 probably null Het
Cyb561a3 G A 19: 10,582,393 W27* probably null Het
Cyp2d12 C A 15: 82,558,056 N297K possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 T C 14: 26,773,023 L1346P probably damaging Het
Dnah12 T A 14: 26,800,075 N1948K probably damaging Het
Dsp T G 13: 38,193,195 L1652R probably damaging Het
Dstyk G A 1: 132,449,595 S66N probably benign Het
Ehhadh T C 16: 21,762,178 E688G probably damaging Het
Emsy T A 7: 98,602,729 H688L possibly damaging Het
Emsy G T 7: 98,602,730 H688N possibly damaging Het
Endod1 A G 9: 14,356,926 L421P probably damaging Het
Fam222b C T 11: 78,155,035 P346L probably damaging Het
Fam3c G A 6: 22,309,437 R182W probably damaging Het
Gck T C 11: 5,910,984 D29G probably damaging Het
Gm10320 C A 13: 98,489,699 R59L probably damaging Het
Gm11127 G T 17: 36,058,004 F61L probably damaging Het
Gm21798 C T 15: 64,817,826 probably benign Het
Gm9376 A G 14: 118,267,545 T130A possibly damaging Het
Gpr153 T A 4: 152,282,392 I334N possibly damaging Het
Greb1l T C 18: 10,509,314 L542P probably damaging Het
Hacl1 T C 14: 31,640,534 E52G probably benign Het
Ice2 A G 9: 69,407,353 Y128C probably damaging Het
Ikzf2 T A 1: 69,542,287 I121L probably benign Het
Ipcef1 C T 10: 6,919,900 A167T probably benign Het
Jakmip2 T A 18: 43,582,080 D127V possibly damaging Het
Jph4 T C 14: 55,114,911 T122A probably damaging Het
Kcns2 A G 15: 34,838,803 E104G probably damaging Het
Lars2 A C 9: 123,431,917 R384S probably benign Het
Lsmem1 T A 12: 40,185,408 H3L possibly damaging Het
Lsmem1 G T 12: 40,185,409 H3N possibly damaging Het
Mfhas1 A C 8: 35,590,068 S566R probably benign Het
Mfhas1 C G 8: 35,590,248 R626G probably benign Het
Mgam A G 6: 40,666,892 T585A probably damaging Het
Mmp25 T C 17: 23,640,023 K185E probably benign Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Mtcp1 A T X: 75,411,665 Y25* probably null Het
Mybl2 A G 2: 163,059,583 T35A probably benign Het
Myh11 T C 16: 14,223,880 E736G probably damaging Het
Mymx T C 17: 45,601,833 probably benign Het
Nek10 A G 14: 14,863,454 probably null Het
Nsd1 A T 13: 55,246,369 K697N probably damaging Het
Nynrin A G 14: 55,872,947 D1837G possibly damaging Het
Olfr115 G A 17: 37,610,277 T158I probably benign Het
Olfr424 T A 1: 174,137,194 I150N probably benign Het
Olfr510 T A 7: 108,667,644 I76N probably benign Het
Olfr593 A T 7: 103,211,886 T9S probably benign Het
Olfr701 A G 7: 106,819,007 H308R probably benign Het
Phf19 T C 2: 34,911,769 T10A probably benign Het
Pkd1 A T 17: 24,565,584 H368L probably benign Het
Plscr2 A G 9: 92,290,755 R156G probably damaging Het
Ppp1r42 G A 1: 10,000,086 R61C probably benign Het
Pptc7 T G 5: 122,313,616 V45G probably damaging Het
Prlhr G A 19: 60,467,429 T233I probably damaging Het
Reps1 C T 10: 18,107,714 T435I probably damaging Het
Ret T A 6: 118,153,951 T1084S probably damaging Het
Rgl2 T A 17: 33,933,621 M402K probably benign Het
Rp2 A G X: 20,376,915 K43R probably benign Het
Rundc3b A T 5: 8,579,117 W95R probably damaging Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Scnn1b G A 7: 121,902,845 R242H probably benign Het
Smad4 G T 18: 73,641,894 Q445K probably benign Het
Smchd1 G T 17: 71,370,337 P1486T probably damaging Het
Snx25 G T 8: 46,035,632 N895K possibly damaging Het
Sox2 A G 3: 34,650,741 D109G probably damaging Het
Stfa2 A T 16: 36,405,202 N38K probably damaging Het
Stfa2 C A 16: 36,405,211 E35D possibly damaging Het
Stfa3 A G 16: 36,450,661 L87P probably damaging Het
Strbp T C 2: 37,640,909 D111G possibly damaging Het
Supt20 C A 3: 54,727,658 probably benign Het
Svep1 A G 4: 58,096,310 Y1437H possibly damaging Het
Tbx4 T A 11: 85,911,920 probably null Het
Tmem117 A T 15: 95,094,551 N364I probably damaging Het
Tmem8 T C 17: 26,122,220 Y766H probably damaging Het
Trat1 T C 16: 48,761,379 E45G probably damaging Het
Trpc2 G A 7: 102,084,119 D92N probably damaging Het
Trpm1 G A 7: 64,226,782 D528N probably damaging Het
Ttll9 A G 2: 153,000,236 S337G possibly damaging Het
Utrn A T 10: 12,475,274 I355N probably damaging Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn1r209 A G 13: 22,806,239 S94P possibly damaging Het
Vmn2r28 T A 7: 5,493,811 Q14L probably benign Het
Vps45 A G 3: 96,047,245 probably null Het
Wdr48 T C 9: 119,904,330 V81A probably benign Het
Xpnpep2 A G X: 48,125,353 N476S probably benign Het
Zbtb41 A T 1: 139,446,922 K707* probably null Het
Zfp442 A C 2: 150,409,063 C306W probably damaging Het
Zfp811 T C 17: 32,798,142 N307S possibly damaging Het
Zfp976 A G 7: 42,616,311 W17R probably damaging Het
Zyg11b T C 4: 108,266,093 T226A possibly damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATTGCAGTCACTGGGGACAAG -3'
(R):5'- ACATGTCCTTCTGGCCAGAG -3'

Sequencing Primer
(F):5'- TGACTGTCACAGAGTCCAGACTG -3'
(R):5'- CTTCTGGCCAGAGTTTTTGATC -3'
Posted On2014-06-23