Incidental Mutation 'R1829:Myh2'
ID 207133
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Name myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms Myhs-f, Myhsf1, MHC2A, Myhs-f1, MyHC-IIa
MMRRC Submission 039856-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.228) question?
Stock # R1829 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 67061853-67088343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67067385 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 224 (I224T)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
AlphaFold G3UW82
Predicted Effect probably damaging
Transcript: ENSMUST00000018641
AA Change: I224T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: I224T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124337
Predicted Effect probably damaging
Transcript: ENSMUST00000170159
AA Change: I224T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: I224T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 A T 8: 111,769,338 (GRCm39) D287V probably damaging Het
Abca12 A G 1: 71,334,188 (GRCm39) C1105R probably benign Het
Abca8b T A 11: 109,833,167 (GRCm39) N1178Y probably damaging Het
Abhd12 A G 2: 150,685,318 (GRCm39) L189P probably damaging Het
Acap2 G T 16: 30,929,752 (GRCm39) N435K probably damaging Het
Adam6b G T 12: 113,453,545 (GRCm39) G121C probably damaging Het
Adgrb1 C A 15: 74,452,435 (GRCm39) C200* probably null Het
Agbl5 T C 5: 31,060,408 (GRCm39) S730P possibly damaging Het
Ahsg G A 16: 22,711,078 (GRCm39) probably benign Het
Aldh9a1 A T 1: 167,189,423 (GRCm39) K390N probably benign Het
Alpk2 T A 18: 65,427,165 (GRCm39) H1857L possibly damaging Het
Apip T A 2: 102,919,007 (GRCm39) N102K probably benign Het
Asxl2 T C 12: 3,507,125 (GRCm39) S106P probably damaging Het
Atp2b2 G T 6: 113,750,329 (GRCm39) R677S probably damaging Het
Barhl1 A C 2: 28,799,857 (GRCm39) M256R probably damaging Het
Cacnb2 A T 2: 14,990,775 (GRCm39) Q619L possibly damaging Het
Ccdc137 C T 11: 120,349,038 (GRCm39) P23L probably benign Het
Cdh11 A T 8: 103,361,273 (GRCm39) N688K possibly damaging Het
Cdh18 C T 15: 23,173,938 (GRCm39) P51S probably damaging Het
Cdin1 G T 2: 115,473,173 (GRCm39) R101L possibly damaging Het
Cfhr1 A T 1: 139,481,338 (GRCm39) Y181N probably damaging Het
Chmp3 A G 6: 71,537,923 (GRCm39) D50G probably benign Het
Crem T C 18: 3,295,037 (GRCm39) probably null Het
Cyb561a3 G A 19: 10,559,757 (GRCm39) W27* probably null Het
Cyp2d12 C A 15: 82,442,257 (GRCm39) N297K possibly damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnah12 T A 14: 26,522,032 (GRCm39) N1948K probably damaging Het
Dnah12 T C 14: 26,494,980 (GRCm39) L1346P probably damaging Het
Dsp T G 13: 38,377,171 (GRCm39) L1652R probably damaging Het
Dstyk G A 1: 132,377,333 (GRCm39) S66N probably benign Het
Ehhadh T C 16: 21,580,928 (GRCm39) E688G probably damaging Het
Emsy G T 7: 98,251,937 (GRCm39) H688N possibly damaging Het
Emsy T A 7: 98,251,936 (GRCm39) H688L possibly damaging Het
Endod1 A G 9: 14,268,222 (GRCm39) L421P probably damaging Het
Fam222b C T 11: 78,045,861 (GRCm39) P346L probably damaging Het
Fam3c G A 6: 22,309,436 (GRCm39) R182W probably damaging Het
Gck T C 11: 5,860,984 (GRCm39) D29G probably damaging Het
Gm10320 C A 13: 98,626,207 (GRCm39) R59L probably damaging Het
Gm21798 C T 15: 64,689,675 (GRCm39) probably benign Het
Gm9376 A G 14: 118,504,957 (GRCm39) T130A possibly damaging Het
Gpr153 T A 4: 152,366,849 (GRCm39) I334N possibly damaging Het
Greb1l T C 18: 10,509,314 (GRCm39) L542P probably damaging Het
H2-T15 G T 17: 36,368,896 (GRCm39) F61L probably damaging Het
Hacl1 T C 14: 31,362,491 (GRCm39) E52G probably benign Het
Ice2 A G 9: 69,314,635 (GRCm39) Y128C probably damaging Het
Ikzf2 T A 1: 69,581,446 (GRCm39) I121L probably benign Het
Ipcef1 C T 10: 6,869,900 (GRCm39) A167T probably benign Het
Jakmip2 T A 18: 43,715,145 (GRCm39) D127V possibly damaging Het
Jph4 T C 14: 55,352,368 (GRCm39) T122A probably damaging Het
Kcns2 A G 15: 34,838,949 (GRCm39) E104G probably damaging Het
Lars2 A C 9: 123,260,982 (GRCm39) R384S probably benign Het
Lsmem1 T A 12: 40,235,407 (GRCm39) H3L possibly damaging Het
Lsmem1 G T 12: 40,235,408 (GRCm39) H3N possibly damaging Het
Ly6g2 T G 15: 75,088,605 (GRCm39) probably null Het
Mfhas1 A C 8: 36,057,222 (GRCm39) S566R probably benign Het
Mfhas1 C G 8: 36,057,402 (GRCm39) R626G probably benign Het
Mgam A G 6: 40,643,826 (GRCm39) T585A probably damaging Het
Mmp25 T C 17: 23,858,997 (GRCm39) K185E probably benign Het
Mtch1 T C 17: 29,557,750 (GRCm39) I243V probably damaging Het
Mtcp1 A T X: 74,455,271 (GRCm39) Y25* probably null Het
Mybl2 A G 2: 162,901,503 (GRCm39) T35A probably benign Het
Myh11 T C 16: 14,041,744 (GRCm39) E736G probably damaging Het
Mymx T C 17: 45,912,759 (GRCm39) probably benign Het
Nek10 A G 14: 14,863,454 (GRCm38) probably null Het
Nsd1 A T 13: 55,394,182 (GRCm39) K697N probably damaging Het
Nynrin A G 14: 56,110,404 (GRCm39) D1837G possibly damaging Het
Or14j4 G A 17: 37,921,168 (GRCm39) T158I probably benign Het
Or2ag2b A G 7: 106,418,214 (GRCm39) H308R probably benign Het
Or52s1 A T 7: 102,861,093 (GRCm39) T9S probably benign Het
Or5p81 T A 7: 108,266,851 (GRCm39) I76N probably benign Het
Or6k4 T A 1: 173,964,760 (GRCm39) I150N probably benign Het
Pgap6 T C 17: 26,341,194 (GRCm39) Y766H probably damaging Het
Phf19 T C 2: 34,801,781 (GRCm39) T10A probably benign Het
Pkd1 A T 17: 24,784,558 (GRCm39) H368L probably benign Het
Plscr2 A G 9: 92,172,808 (GRCm39) R156G probably damaging Het
Ppp1r42 G A 1: 10,070,311 (GRCm39) R61C probably benign Het
Pptc7 T G 5: 122,451,679 (GRCm39) V45G probably damaging Het
Prlhr G A 19: 60,455,867 (GRCm39) T233I probably damaging Het
Prr23a4 T A 9: 98,785,446 (GRCm39) I37N possibly damaging Het
Reps1 C T 10: 17,983,462 (GRCm39) T435I probably damaging Het
Ret T A 6: 118,130,912 (GRCm39) T1084S probably damaging Het
Rgl2 T A 17: 34,152,595 (GRCm39) M402K probably benign Het
Rp2 A G X: 20,243,154 (GRCm39) K43R probably benign Het
Rundc3b A T 5: 8,629,117 (GRCm39) W95R probably damaging Het
Samd9l T C 6: 3,375,107 (GRCm39) D718G possibly damaging Het
Scnn1b G A 7: 121,502,068 (GRCm39) R242H probably benign Het
Smad4 G T 18: 73,774,965 (GRCm39) Q445K probably benign Het
Smchd1 G T 17: 71,677,332 (GRCm39) P1486T probably damaging Het
Snx25 G T 8: 46,488,669 (GRCm39) N895K possibly damaging Het
Sox2 A G 3: 34,704,890 (GRCm39) D109G probably damaging Het
Stfa2 A T 16: 36,225,564 (GRCm39) N38K probably damaging Het
Stfa2 C A 16: 36,225,573 (GRCm39) E35D possibly damaging Het
Stfa3 A G 16: 36,271,023 (GRCm39) L87P probably damaging Het
Strbp T C 2: 37,530,921 (GRCm39) D111G possibly damaging Het
Supt20 C A 3: 54,635,079 (GRCm39) probably benign Het
Svep1 A G 4: 58,096,310 (GRCm39) Y1437H possibly damaging Het
Tbx4 T A 11: 85,802,746 (GRCm39) probably null Het
Tmem117 A T 15: 94,992,432 (GRCm39) N364I probably damaging Het
Trat1 T C 16: 48,581,742 (GRCm39) E45G probably damaging Het
Trpc2 G A 7: 101,733,326 (GRCm39) D92N probably damaging Het
Trpm1 G A 7: 63,876,530 (GRCm39) D528N probably damaging Het
Ttll9 A G 2: 152,842,156 (GRCm39) S337G possibly damaging Het
Utrn A T 10: 12,351,018 (GRCm39) I355N probably damaging Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn1r209 A G 13: 22,990,409 (GRCm39) S94P possibly damaging Het
Vmn2r28 T A 7: 5,496,810 (GRCm39) Q14L probably benign Het
Vps45 A G 3: 95,954,557 (GRCm39) probably null Het
Wdr48 T C 9: 119,733,396 (GRCm39) V81A probably benign Het
Xpnpep2 A G X: 47,214,230 (GRCm39) N476S probably benign Het
Zbtb41 A T 1: 139,374,660 (GRCm39) K707* probably null Het
Zfp442 A C 2: 150,250,983 (GRCm39) C306W probably damaging Het
Zfp811 T C 17: 33,017,116 (GRCm39) N307S possibly damaging Het
Zfp976 A G 7: 42,265,735 (GRCm39) W17R probably damaging Het
Zyg11b T C 4: 108,123,290 (GRCm39) T226A possibly damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67,076,059 (GRCm39) missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67,084,266 (GRCm39) missense probably benign 0.06
IGL00423:Myh2 APN 11 67,088,171 (GRCm39) missense probably benign
IGL00429:Myh2 APN 11 67,071,616 (GRCm39) nonsense probably null
IGL00465:Myh2 APN 11 67,069,659 (GRCm39) splice site probably benign
IGL00671:Myh2 APN 11 67,084,183 (GRCm39) missense probably damaging 0.97
IGL00773:Myh2 APN 11 67,085,247 (GRCm39) missense probably benign
IGL00821:Myh2 APN 11 67,088,223 (GRCm39) utr 3 prime probably benign
IGL00900:Myh2 APN 11 67,070,210 (GRCm39) missense probably damaging 1.00
IGL01374:Myh2 APN 11 67,068,250 (GRCm39) missense probably benign 0.05
IGL01613:Myh2 APN 11 67,088,170 (GRCm39) missense probably benign 0.01
IGL01845:Myh2 APN 11 67,083,860 (GRCm39) missense probably benign 0.02
IGL01900:Myh2 APN 11 67,074,609 (GRCm39) missense probably benign 0.01
IGL01936:Myh2 APN 11 67,082,599 (GRCm39) missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67,076,084 (GRCm39) missense probably benign 0.05
IGL02172:Myh2 APN 11 67,079,878 (GRCm39) missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67,079,991 (GRCm39) missense probably benign 0.00
IGL02578:Myh2 APN 11 67,077,517 (GRCm39) missense probably benign 0.33
IGL03075:Myh2 APN 11 67,071,662 (GRCm39) missense probably benign 0.39
IGL03078:Myh2 APN 11 67,081,256 (GRCm39) missense probably benign
IGL03117:Myh2 APN 11 67,071,710 (GRCm39) missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67,084,051 (GRCm39) missense probably damaging 1.00
IGL03266:Myh2 APN 11 67,067,150 (GRCm39) missense probably benign
IGL03366:Myh2 APN 11 67,074,349 (GRCm39) missense probably damaging 1.00
IGL03412:Myh2 APN 11 67,080,395 (GRCm39) missense probably benign 0.04
limp UTSW 11 67,083,330 (GRCm39) missense probably damaging 1.00
noodle UTSW 11 67,077,438 (GRCm39) missense probably benign
PIT4403001:Myh2 UTSW 11 67,077,533 (GRCm39) missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67,076,331 (GRCm39) missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67,072,818 (GRCm39) missense probably benign
R0039:Myh2 UTSW 11 67,069,103 (GRCm39) missense probably damaging 1.00
R0347:Myh2 UTSW 11 67,076,130 (GRCm39) splice site probably benign
R0389:Myh2 UTSW 11 67,071,647 (GRCm39) missense probably damaging 1.00
R0400:Myh2 UTSW 11 67,083,424 (GRCm39) splice site probably benign
R0512:Myh2 UTSW 11 67,079,504 (GRCm39) missense probably damaging 1.00
R0555:Myh2 UTSW 11 67,069,793 (GRCm39) missense probably damaging 1.00
R0746:Myh2 UTSW 11 67,064,257 (GRCm39) missense probably benign 0.00
R0842:Myh2 UTSW 11 67,070,350 (GRCm39) missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67,077,334 (GRCm39) missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67,083,351 (GRCm39) missense probably damaging 0.99
R1264:Myh2 UTSW 11 67,071,604 (GRCm39) missense probably damaging 0.96
R1398:Myh2 UTSW 11 67,076,113 (GRCm39) missense probably benign 0.14
R1774:Myh2 UTSW 11 67,064,300 (GRCm39) missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67,079,764 (GRCm39) missense probably damaging 0.99
R1840:Myh2 UTSW 11 67,077,313 (GRCm39) missense probably benign 0.16
R1888:Myh2 UTSW 11 67,071,676 (GRCm39) missense probably damaging 0.99
R1888:Myh2 UTSW 11 67,071,676 (GRCm39) missense probably damaging 0.99
R1969:Myh2 UTSW 11 67,080,004 (GRCm39) missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67,080,004 (GRCm39) missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67,071,740 (GRCm39) missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67,082,545 (GRCm39) missense probably damaging 1.00
R2029:Myh2 UTSW 11 67,085,451 (GRCm39) missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67,079,665 (GRCm39) critical splice donor site probably null
R2080:Myh2 UTSW 11 67,065,767 (GRCm39) critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67,080,158 (GRCm39) missense probably damaging 1.00
R2215:Myh2 UTSW 11 67,082,563 (GRCm39) missense probably benign 0.35
R2225:Myh2 UTSW 11 67,084,555 (GRCm39) missense probably benign
R2274:Myh2 UTSW 11 67,081,184 (GRCm39) missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67,070,410 (GRCm39) missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67,076,012 (GRCm39) missense probably damaging 1.00
R3703:Myh2 UTSW 11 67,080,427 (GRCm39) missense probably benign 0.01
R4022:Myh2 UTSW 11 67,070,230 (GRCm39) nonsense probably null
R4081:Myh2 UTSW 11 67,081,256 (GRCm39) missense probably benign 0.11
R4191:Myh2 UTSW 11 67,068,226 (GRCm39) missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67,071,985 (GRCm39) missense probably benign 0.01
R4292:Myh2 UTSW 11 67,085,723 (GRCm39) missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67,083,551 (GRCm39) missense probably benign 0.01
R4524:Myh2 UTSW 11 67,067,096 (GRCm39) missense probably damaging 1.00
R4578:Myh2 UTSW 11 67,064,084 (GRCm39) missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67,080,244 (GRCm39) missense probably benign 0.01
R4641:Myh2 UTSW 11 67,085,520 (GRCm39) missense probably damaging 1.00
R4672:Myh2 UTSW 11 67,079,303 (GRCm39) missense probably damaging 1.00
R4673:Myh2 UTSW 11 67,079,303 (GRCm39) missense probably damaging 1.00
R4804:Myh2 UTSW 11 67,077,328 (GRCm39) missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67,067,081 (GRCm39) missense probably damaging 1.00
R4943:Myh2 UTSW 11 67,088,143 (GRCm39) missense probably damaging 1.00
R4958:Myh2 UTSW 11 67,083,785 (GRCm39) missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67,070,174 (GRCm39) missense probably damaging 1.00
R5239:Myh2 UTSW 11 67,083,269 (GRCm39) missense probably benign 0.00
R5306:Myh2 UTSW 11 67,077,382 (GRCm39) missense probably damaging 1.00
R5492:Myh2 UTSW 11 67,071,701 (GRCm39) missense probably benign 0.20
R5503:Myh2 UTSW 11 67,064,275 (GRCm39) missense probably benign
R5646:Myh2 UTSW 11 67,079,638 (GRCm39) missense probably benign 0.07
R5750:Myh2 UTSW 11 67,082,254 (GRCm39) missense probably benign
R5806:Myh2 UTSW 11 67,072,141 (GRCm39) missense probably damaging 0.98
R5878:Myh2 UTSW 11 67,083,330 (GRCm39) missense probably damaging 1.00
R5892:Myh2 UTSW 11 67,076,002 (GRCm39) nonsense probably null
R5898:Myh2 UTSW 11 67,083,545 (GRCm39) missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67,077,438 (GRCm39) missense probably benign
R6156:Myh2 UTSW 11 67,071,879 (GRCm39) missense probably damaging 0.98
R6236:Myh2 UTSW 11 67,081,157 (GRCm39) missense probably benign 0.00
R6349:Myh2 UTSW 11 67,083,829 (GRCm39) missense probably benign 0.04
R6441:Myh2 UTSW 11 67,085,437 (GRCm39) missense probably benign 0.00
R6548:Myh2 UTSW 11 67,077,438 (GRCm39) missense probably benign
R6681:Myh2 UTSW 11 67,069,174 (GRCm39) missense probably damaging 1.00
R6907:Myh2 UTSW 11 67,084,567 (GRCm39) missense probably damaging 1.00
R6925:Myh2 UTSW 11 67,084,044 (GRCm39) missense probably benign 0.00
R6969:Myh2 UTSW 11 67,088,092 (GRCm39) missense probably benign
R7172:Myh2 UTSW 11 67,079,527 (GRCm39) missense probably benign 0.00
R7257:Myh2 UTSW 11 67,071,976 (GRCm39) missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67,079,195 (GRCm39) missense probably benign 0.23
R7323:Myh2 UTSW 11 67,088,191 (GRCm39) missense probably benign
R7396:Myh2 UTSW 11 67,085,554 (GRCm39) critical splice donor site probably null
R7468:Myh2 UTSW 11 67,083,368 (GRCm39) missense probably benign 0.01
R7585:Myh2 UTSW 11 67,070,237 (GRCm39) critical splice donor site probably null
R7709:Myh2 UTSW 11 67,085,690 (GRCm39) missense probably benign 0.00
R7859:Myh2 UTSW 11 67,077,526 (GRCm39) missense probably damaging 0.96
R7908:Myh2 UTSW 11 67,088,197 (GRCm39) missense probably benign
R8062:Myh2 UTSW 11 67,084,209 (GRCm39) nonsense probably null
R8065:Myh2 UTSW 11 67,072,170 (GRCm39) missense probably null 0.01
R8093:Myh2 UTSW 11 67,079,536 (GRCm39) missense probably damaging 1.00
R8123:Myh2 UTSW 11 67,064,135 (GRCm39) missense probably benign
R8235:Myh2 UTSW 11 67,083,824 (GRCm39) missense probably damaging 1.00
R8512:Myh2 UTSW 11 67,081,187 (GRCm39) missense probably benign 0.11
R8762:Myh2 UTSW 11 67,084,578 (GRCm39) missense probably damaging 1.00
R8777:Myh2 UTSW 11 67,083,398 (GRCm39) missense possibly damaging 0.67
R8777-TAIL:Myh2 UTSW 11 67,083,398 (GRCm39) missense possibly damaging 0.67
R8823:Myh2 UTSW 11 67,076,300 (GRCm39) missense probably damaging 1.00
R8927:Myh2 UTSW 11 67,079,509 (GRCm39) missense probably benign 0.00
R8928:Myh2 UTSW 11 67,079,509 (GRCm39) missense probably benign 0.00
R8978:Myh2 UTSW 11 67,080,323 (GRCm39) missense probably damaging 0.98
R8978:Myh2 UTSW 11 67,068,188 (GRCm39) missense probably damaging 0.96
R9228:Myh2 UTSW 11 67,077,522 (GRCm39) missense probably benign 0.11
R9332:Myh2 UTSW 11 67,070,209 (GRCm39) missense probably damaging 1.00
R9404:Myh2 UTSW 11 67,070,454 (GRCm39) missense probably damaging 1.00
R9430:Myh2 UTSW 11 67,070,359 (GRCm39) missense probably benign 0.01
R9445:Myh2 UTSW 11 67,069,754 (GRCm39) missense probably damaging 0.98
R9542:Myh2 UTSW 11 67,072,002 (GRCm39) missense possibly damaging 0.73
R9597:Myh2 UTSW 11 67,064,302 (GRCm39) missense possibly damaging 0.75
R9654:Myh2 UTSW 11 67,088,171 (GRCm39) missense probably benign
R9704:Myh2 UTSW 11 67,071,617 (GRCm39) missense possibly damaging 0.51
R9736:Myh2 UTSW 11 67,063,999 (GRCm39) missense probably benign 0.00
R9740:Myh2 UTSW 11 67,080,052 (GRCm39) missense probably damaging 0.99
X0026:Myh2 UTSW 11 67,065,848 (GRCm39) missense probably benign 0.10
X0065:Myh2 UTSW 11 67,067,085 (GRCm39) missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67,071,589 (GRCm39) critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67,082,275 (GRCm39) missense probably damaging 0.98
Z1177:Myh2 UTSW 11 67,084,084 (GRCm39) missense probably damaging 0.99
Z1177:Myh2 UTSW 11 67,066,997 (GRCm39) missense possibly damaging 0.86
Z1188:Myh2 UTSW 11 67,079,639 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AATTGCAGTCACTGGGGACAAG -3'
(R):5'- ACATGTCCTTCTGGCCAGAG -3'

Sequencing Primer
(F):5'- TGACTGTCACAGAGTCCAGACTG -3'
(R):5'- CTTCTGGCCAGAGTTTTTGATC -3'
Posted On 2014-06-23