Incidental Mutation 'R1829:Adam6b'
ID207143
Institutional Source Beutler Lab
Gene Symbol Adam6b
Ensembl Gene ENSMUSG00000051804
Gene Namea disintegrin and metallopeptidase domain 6B
Synonyms4930523C11Rik
MMRRC Submission 039856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1829 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113489511-113492057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113489925 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 121 (G121C)
Ref Sequence ENSEMBL: ENSMUSP00000065529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063317]
Predicted Effect probably damaging
Transcript: ENSMUST00000063317
AA Change: G121C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065529
Gene: ENSMUSG00000051804
AA Change: G121C

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 1.1e-16 PFAM
Pfam:Reprolysin 223 407 1.1e-14 PFAM
DISIN 427 502 9.2e-33 SMART
ACR 503 640 2.74e-60 SMART
transmembrane domain 704 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T A 9: 98,903,393 I37N possibly damaging Het
Aars A T 8: 111,042,706 D287V probably damaging Het
Abca12 A G 1: 71,295,029 C1105R probably benign Het
Abca8b T A 11: 109,942,341 N1178Y probably damaging Het
Abhd12 A G 2: 150,843,398 L189P probably damaging Het
Acap2 G T 16: 31,110,934 N435K probably damaging Het
Adgrb1 C A 15: 74,580,586 C200* probably null Het
Agbl5 T C 5: 30,903,064 S730P possibly damaging Het
Ahsg G A 16: 22,892,328 probably benign Het
Aldh9a1 A T 1: 167,361,854 K390N probably benign Het
Alpk2 T A 18: 65,294,094 H1857L possibly damaging Het
Apip T A 2: 103,088,662 N102K probably benign Het
Asxl2 T C 12: 3,457,125 S106P probably damaging Het
Atp2b2 G T 6: 113,773,368 R677S probably damaging Het
Barhl1 A C 2: 28,909,845 M256R probably damaging Het
BC025446 T G 15: 75,216,756 probably null Het
BC052040 G T 2: 115,642,692 R101L possibly damaging Het
Cacnb2 A T 2: 14,985,964 Q619L possibly damaging Het
Ccdc137 C T 11: 120,458,212 P23L probably benign Het
Cdh11 A T 8: 102,634,641 N688K possibly damaging Het
Cdh18 C T 15: 23,173,852 P51S probably damaging Het
Cfhr1 A T 1: 139,553,600 Y181N probably damaging Het
Chmp3 A G 6: 71,560,939 D50G probably benign Het
Crem T C 18: 3,295,037 probably null Het
Cyb561a3 G A 19: 10,582,393 W27* probably null Het
Cyp2d12 C A 15: 82,558,056 N297K possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 T C 14: 26,773,023 L1346P probably damaging Het
Dnah12 T A 14: 26,800,075 N1948K probably damaging Het
Dsp T G 13: 38,193,195 L1652R probably damaging Het
Dstyk G A 1: 132,449,595 S66N probably benign Het
Ehhadh T C 16: 21,762,178 E688G probably damaging Het
Emsy T A 7: 98,602,729 H688L possibly damaging Het
Emsy G T 7: 98,602,730 H688N possibly damaging Het
Endod1 A G 9: 14,356,926 L421P probably damaging Het
Fam222b C T 11: 78,155,035 P346L probably damaging Het
Fam3c G A 6: 22,309,437 R182W probably damaging Het
Gck T C 11: 5,910,984 D29G probably damaging Het
Gm10320 C A 13: 98,489,699 R59L probably damaging Het
Gm11127 G T 17: 36,058,004 F61L probably damaging Het
Gm21798 C T 15: 64,817,826 probably benign Het
Gm9376 A G 14: 118,267,545 T130A possibly damaging Het
Gpr153 T A 4: 152,282,392 I334N possibly damaging Het
Greb1l T C 18: 10,509,314 L542P probably damaging Het
Hacl1 T C 14: 31,640,534 E52G probably benign Het
Ice2 A G 9: 69,407,353 Y128C probably damaging Het
Ikzf2 T A 1: 69,542,287 I121L probably benign Het
Ipcef1 C T 10: 6,919,900 A167T probably benign Het
Jakmip2 T A 18: 43,582,080 D127V possibly damaging Het
Jph4 T C 14: 55,114,911 T122A probably damaging Het
Kcns2 A G 15: 34,838,803 E104G probably damaging Het
Lars2 A C 9: 123,431,917 R384S probably benign Het
Lsmem1 T A 12: 40,185,408 H3L possibly damaging Het
Lsmem1 G T 12: 40,185,409 H3N possibly damaging Het
Mfhas1 A C 8: 35,590,068 S566R probably benign Het
Mfhas1 C G 8: 35,590,248 R626G probably benign Het
Mgam A G 6: 40,666,892 T585A probably damaging Het
Mmp25 T C 17: 23,640,023 K185E probably benign Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Mtcp1 A T X: 75,411,665 Y25* probably null Het
Mybl2 A G 2: 163,059,583 T35A probably benign Het
Myh11 T C 16: 14,223,880 E736G probably damaging Het
Myh2 T C 11: 67,176,559 I224T probably damaging Het
Mymx T C 17: 45,601,833 probably benign Het
Nek10 A G 14: 14,863,454 probably null Het
Nsd1 A T 13: 55,246,369 K697N probably damaging Het
Nynrin A G 14: 55,872,947 D1837G possibly damaging Het
Olfr115 G A 17: 37,610,277 T158I probably benign Het
Olfr424 T A 1: 174,137,194 I150N probably benign Het
Olfr510 T A 7: 108,667,644 I76N probably benign Het
Olfr593 A T 7: 103,211,886 T9S probably benign Het
Olfr701 A G 7: 106,819,007 H308R probably benign Het
Phf19 T C 2: 34,911,769 T10A probably benign Het
Pkd1 A T 17: 24,565,584 H368L probably benign Het
Plscr2 A G 9: 92,290,755 R156G probably damaging Het
Ppp1r42 G A 1: 10,000,086 R61C probably benign Het
Pptc7 T G 5: 122,313,616 V45G probably damaging Het
Prlhr G A 19: 60,467,429 T233I probably damaging Het
Reps1 C T 10: 18,107,714 T435I probably damaging Het
Ret T A 6: 118,153,951 T1084S probably damaging Het
Rgl2 T A 17: 33,933,621 M402K probably benign Het
Rp2 A G X: 20,376,915 K43R probably benign Het
Rundc3b A T 5: 8,579,117 W95R probably damaging Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Scnn1b G A 7: 121,902,845 R242H probably benign Het
Smad4 G T 18: 73,641,894 Q445K probably benign Het
Smchd1 G T 17: 71,370,337 P1486T probably damaging Het
Snx25 G T 8: 46,035,632 N895K possibly damaging Het
Sox2 A G 3: 34,650,741 D109G probably damaging Het
Stfa2 A T 16: 36,405,202 N38K probably damaging Het
Stfa2 C A 16: 36,405,211 E35D possibly damaging Het
Stfa3 A G 16: 36,450,661 L87P probably damaging Het
Strbp T C 2: 37,640,909 D111G possibly damaging Het
Supt20 C A 3: 54,727,658 probably benign Het
Svep1 A G 4: 58,096,310 Y1437H possibly damaging Het
Tbx4 T A 11: 85,911,920 probably null Het
Tmem117 A T 15: 95,094,551 N364I probably damaging Het
Tmem8 T C 17: 26,122,220 Y766H probably damaging Het
Trat1 T C 16: 48,761,379 E45G probably damaging Het
Trpc2 G A 7: 102,084,119 D92N probably damaging Het
Trpm1 G A 7: 64,226,782 D528N probably damaging Het
Ttll9 A G 2: 153,000,236 S337G possibly damaging Het
Utrn A T 10: 12,475,274 I355N probably damaging Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn1r209 A G 13: 22,806,239 S94P possibly damaging Het
Vmn2r28 T A 7: 5,493,811 Q14L probably benign Het
Vps45 A G 3: 96,047,245 probably null Het
Wdr48 T C 9: 119,904,330 V81A probably benign Het
Xpnpep2 A G X: 48,125,353 N476S probably benign Het
Zbtb41 A T 1: 139,446,922 K707* probably null Het
Zfp442 A C 2: 150,409,063 C306W probably damaging Het
Zfp811 T C 17: 32,798,142 N307S possibly damaging Het
Zfp976 A G 7: 42,616,311 W17R probably damaging Het
Zyg11b T C 4: 108,266,093 T226A possibly damaging Het
Other mutations in Adam6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adam6b APN 12 113491393 missense probably damaging 1.00
IGL00800:Adam6b APN 12 113490442 missense probably benign 0.24
IGL01456:Adam6b APN 12 113491463 missense probably benign 0.30
IGL02232:Adam6b APN 12 113491144 missense probably benign 0.06
IGL03039:Adam6b APN 12 113490882 missense probably damaging 1.00
IGL03399:Adam6b APN 12 113491108 missense probably damaging 0.97
IGL03412:Adam6b APN 12 113491770 nonsense probably null
R0234:Adam6b UTSW 12 113490610 missense probably damaging 0.98
R0234:Adam6b UTSW 12 113490610 missense probably damaging 0.98
R0373:Adam6b UTSW 12 113490655 missense probably benign 0.15
R0402:Adam6b UTSW 12 113489995 missense probably damaging 0.96
R0420:Adam6b UTSW 12 113489994 missense probably benign 0.02
R0573:Adam6b UTSW 12 113491658 missense possibly damaging 0.90
R0884:Adam6b UTSW 12 113490995 missense probably damaging 1.00
R1489:Adam6b UTSW 12 113491451 missense probably benign 0.15
R1542:Adam6b UTSW 12 113490939 missense possibly damaging 0.53
R1591:Adam6b UTSW 12 113489832 missense probably benign 0.07
R1596:Adam6b UTSW 12 113491026 missense probably damaging 1.00
R1675:Adam6b UTSW 12 113491044 missense probably benign 0.00
R1699:Adam6b UTSW 12 113490585 missense probably benign 0.02
R1818:Adam6b UTSW 12 113491256 missense probably benign 0.15
R1851:Adam6b UTSW 12 113491822 missense probably benign 0.44
R1955:Adam6b UTSW 12 113491816 missense probably benign 0.16
R2040:Adam6b UTSW 12 113490744 missense probably benign 0.34
R3820:Adam6b UTSW 12 113490364 missense probably benign 0.38
R4112:Adam6b UTSW 12 113489636 missense possibly damaging 0.85
R4434:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4435:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4437:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4438:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4509:Adam6b UTSW 12 113490352 missense probably benign 0.02
R5034:Adam6b UTSW 12 113490927 missense probably damaging 1.00
R5316:Adam6b UTSW 12 113491393 missense probably damaging 1.00
R5330:Adam6b UTSW 12 113490580 missense possibly damaging 0.45
R5331:Adam6b UTSW 12 113490580 missense possibly damaging 0.45
R5604:Adam6b UTSW 12 113490800 nonsense probably null
R5698:Adam6b UTSW 12 113491463 missense probably benign 0.30
R5877:Adam6b UTSW 12 113490202 missense probably damaging 1.00
R6235:Adam6b UTSW 12 113491710 missense probably benign
R6254:Adam6b UTSW 12 113489570 missense probably damaging 0.99
R6371:Adam6b UTSW 12 113490274 missense probably damaging 0.99
R6617:Adam6b UTSW 12 113490532 missense possibly damaging 0.78
R6768:Adam6b UTSW 12 113490243 missense probably benign 0.01
R7002:Adam6b UTSW 12 113489707 nonsense probably null
R7003:Adam6b UTSW 12 113490042 nonsense probably null
R7049:Adam6b UTSW 12 113490502 missense probably damaging 0.99
R7313:Adam6b UTSW 12 113491134 missense probably benign 0.00
R7372:Adam6b UTSW 12 113490164 missense probably benign 0.24
R7684:Adam6b UTSW 12 113491576 nonsense probably null
R7777:Adam6b UTSW 12 113490138 missense possibly damaging 0.93
R7781:Adam6b UTSW 12 113491342 missense probably damaging 1.00
R7857:Adam6b UTSW 12 113490484 missense probably benign 0.09
R7940:Adam6b UTSW 12 113490484 missense probably benign 0.09
RF012:Adam6b UTSW 12 113489932 missense probably damaging 1.00
RF022:Adam6b UTSW 12 113491669 missense possibly damaging 0.90
T0722:Adam6b UTSW 12 113489577 missense possibly damaging 0.91
T0722:Adam6b UTSW 12 113491268 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTCATCGGAGGTGGTTATTCC -3'
(R):5'- TCATAGGCCCTGTGTCATCAG -3'

Sequencing Primer
(F):5'- TCGGAAGGAGATCTACCATACC -3'
(R):5'- TGTGTCATCAGACTCAGATACTATC -3'
Posted On2014-06-23