Incidental Mutation 'R1829:Vmn1r209'
ID 207144
Institutional Source Beutler Lab
Gene Symbol Vmn1r209
Ensembl Gene ENSMUSG00000071491
Gene Name vomeronasal 1 receptor 209
Synonyms Gm11315
MMRRC Submission 039856-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R1829 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 22989750-22990688 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22990409 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 94 (S94P)
Ref Sequence ENSEMBL: ENSMUSP00000153997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095961] [ENSMUST00000227038] [ENSMUST00000227265]
AlphaFold Q5NC97
Predicted Effect possibly damaging
Transcript: ENSMUST00000095961
AA Change: S94P

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093657
Gene: ENSMUSG00000071491
AA Change: S94P

DomainStartEndE-ValueType
Pfam:TAS2R 2 294 9.8e-9 PFAM
Pfam:V1R 34 297 3e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227038
AA Change: S94P

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227265
AA Change: S94P

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 A T 8: 111,769,338 (GRCm39) D287V probably damaging Het
Abca12 A G 1: 71,334,188 (GRCm39) C1105R probably benign Het
Abca8b T A 11: 109,833,167 (GRCm39) N1178Y probably damaging Het
Abhd12 A G 2: 150,685,318 (GRCm39) L189P probably damaging Het
Acap2 G T 16: 30,929,752 (GRCm39) N435K probably damaging Het
Adam6b G T 12: 113,453,545 (GRCm39) G121C probably damaging Het
Adgrb1 C A 15: 74,452,435 (GRCm39) C200* probably null Het
Agbl5 T C 5: 31,060,408 (GRCm39) S730P possibly damaging Het
Ahsg G A 16: 22,711,078 (GRCm39) probably benign Het
Aldh9a1 A T 1: 167,189,423 (GRCm39) K390N probably benign Het
Alpk2 T A 18: 65,427,165 (GRCm39) H1857L possibly damaging Het
Apip T A 2: 102,919,007 (GRCm39) N102K probably benign Het
Asxl2 T C 12: 3,507,125 (GRCm39) S106P probably damaging Het
Atp2b2 G T 6: 113,750,329 (GRCm39) R677S probably damaging Het
Barhl1 A C 2: 28,799,857 (GRCm39) M256R probably damaging Het
Cacnb2 A T 2: 14,990,775 (GRCm39) Q619L possibly damaging Het
Ccdc137 C T 11: 120,349,038 (GRCm39) P23L probably benign Het
Cdh11 A T 8: 103,361,273 (GRCm39) N688K possibly damaging Het
Cdh18 C T 15: 23,173,938 (GRCm39) P51S probably damaging Het
Cdin1 G T 2: 115,473,173 (GRCm39) R101L possibly damaging Het
Cfhr1 A T 1: 139,481,338 (GRCm39) Y181N probably damaging Het
Chmp3 A G 6: 71,537,923 (GRCm39) D50G probably benign Het
Crem T C 18: 3,295,037 (GRCm39) probably null Het
Cyb561a3 G A 19: 10,559,757 (GRCm39) W27* probably null Het
Cyp2d12 C A 15: 82,442,257 (GRCm39) N297K possibly damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnah12 T A 14: 26,522,032 (GRCm39) N1948K probably damaging Het
Dnah12 T C 14: 26,494,980 (GRCm39) L1346P probably damaging Het
Dsp T G 13: 38,377,171 (GRCm39) L1652R probably damaging Het
Dstyk G A 1: 132,377,333 (GRCm39) S66N probably benign Het
Ehhadh T C 16: 21,580,928 (GRCm39) E688G probably damaging Het
Emsy G T 7: 98,251,937 (GRCm39) H688N possibly damaging Het
Emsy T A 7: 98,251,936 (GRCm39) H688L possibly damaging Het
Endod1 A G 9: 14,268,222 (GRCm39) L421P probably damaging Het
Fam222b C T 11: 78,045,861 (GRCm39) P346L probably damaging Het
Fam3c G A 6: 22,309,436 (GRCm39) R182W probably damaging Het
Gck T C 11: 5,860,984 (GRCm39) D29G probably damaging Het
Gm10320 C A 13: 98,626,207 (GRCm39) R59L probably damaging Het
Gm21798 C T 15: 64,689,675 (GRCm39) probably benign Het
Gm9376 A G 14: 118,504,957 (GRCm39) T130A possibly damaging Het
Gpr153 T A 4: 152,366,849 (GRCm39) I334N possibly damaging Het
Greb1l T C 18: 10,509,314 (GRCm39) L542P probably damaging Het
H2-T15 G T 17: 36,368,896 (GRCm39) F61L probably damaging Het
Hacl1 T C 14: 31,362,491 (GRCm39) E52G probably benign Het
Ice2 A G 9: 69,314,635 (GRCm39) Y128C probably damaging Het
Ikzf2 T A 1: 69,581,446 (GRCm39) I121L probably benign Het
Ipcef1 C T 10: 6,869,900 (GRCm39) A167T probably benign Het
Jakmip2 T A 18: 43,715,145 (GRCm39) D127V possibly damaging Het
Jph4 T C 14: 55,352,368 (GRCm39) T122A probably damaging Het
Kcns2 A G 15: 34,838,949 (GRCm39) E104G probably damaging Het
Lars2 A C 9: 123,260,982 (GRCm39) R384S probably benign Het
Lsmem1 T A 12: 40,235,407 (GRCm39) H3L possibly damaging Het
Lsmem1 G T 12: 40,235,408 (GRCm39) H3N possibly damaging Het
Ly6g2 T G 15: 75,088,605 (GRCm39) probably null Het
Mfhas1 A C 8: 36,057,222 (GRCm39) S566R probably benign Het
Mfhas1 C G 8: 36,057,402 (GRCm39) R626G probably benign Het
Mgam A G 6: 40,643,826 (GRCm39) T585A probably damaging Het
Mmp25 T C 17: 23,858,997 (GRCm39) K185E probably benign Het
Mtch1 T C 17: 29,557,750 (GRCm39) I243V probably damaging Het
Mtcp1 A T X: 74,455,271 (GRCm39) Y25* probably null Het
Mybl2 A G 2: 162,901,503 (GRCm39) T35A probably benign Het
Myh11 T C 16: 14,041,744 (GRCm39) E736G probably damaging Het
Myh2 T C 11: 67,067,385 (GRCm39) I224T probably damaging Het
Mymx T C 17: 45,912,759 (GRCm39) probably benign Het
Nek10 A G 14: 14,863,454 (GRCm38) probably null Het
Nsd1 A T 13: 55,394,182 (GRCm39) K697N probably damaging Het
Nynrin A G 14: 56,110,404 (GRCm39) D1837G possibly damaging Het
Or14j4 G A 17: 37,921,168 (GRCm39) T158I probably benign Het
Or2ag2b A G 7: 106,418,214 (GRCm39) H308R probably benign Het
Or52s1 A T 7: 102,861,093 (GRCm39) T9S probably benign Het
Or5p81 T A 7: 108,266,851 (GRCm39) I76N probably benign Het
Or6k4 T A 1: 173,964,760 (GRCm39) I150N probably benign Het
Pgap6 T C 17: 26,341,194 (GRCm39) Y766H probably damaging Het
Phf19 T C 2: 34,801,781 (GRCm39) T10A probably benign Het
Pkd1 A T 17: 24,784,558 (GRCm39) H368L probably benign Het
Plscr2 A G 9: 92,172,808 (GRCm39) R156G probably damaging Het
Ppp1r42 G A 1: 10,070,311 (GRCm39) R61C probably benign Het
Pptc7 T G 5: 122,451,679 (GRCm39) V45G probably damaging Het
Prlhr G A 19: 60,455,867 (GRCm39) T233I probably damaging Het
Prr23a4 T A 9: 98,785,446 (GRCm39) I37N possibly damaging Het
Reps1 C T 10: 17,983,462 (GRCm39) T435I probably damaging Het
Ret T A 6: 118,130,912 (GRCm39) T1084S probably damaging Het
Rgl2 T A 17: 34,152,595 (GRCm39) M402K probably benign Het
Rp2 A G X: 20,243,154 (GRCm39) K43R probably benign Het
Rundc3b A T 5: 8,629,117 (GRCm39) W95R probably damaging Het
Samd9l T C 6: 3,375,107 (GRCm39) D718G possibly damaging Het
Scnn1b G A 7: 121,502,068 (GRCm39) R242H probably benign Het
Smad4 G T 18: 73,774,965 (GRCm39) Q445K probably benign Het
Smchd1 G T 17: 71,677,332 (GRCm39) P1486T probably damaging Het
Snx25 G T 8: 46,488,669 (GRCm39) N895K possibly damaging Het
Sox2 A G 3: 34,704,890 (GRCm39) D109G probably damaging Het
Stfa2 A T 16: 36,225,564 (GRCm39) N38K probably damaging Het
Stfa2 C A 16: 36,225,573 (GRCm39) E35D possibly damaging Het
Stfa3 A G 16: 36,271,023 (GRCm39) L87P probably damaging Het
Strbp T C 2: 37,530,921 (GRCm39) D111G possibly damaging Het
Supt20 C A 3: 54,635,079 (GRCm39) probably benign Het
Svep1 A G 4: 58,096,310 (GRCm39) Y1437H possibly damaging Het
Tbx4 T A 11: 85,802,746 (GRCm39) probably null Het
Tmem117 A T 15: 94,992,432 (GRCm39) N364I probably damaging Het
Trat1 T C 16: 48,581,742 (GRCm39) E45G probably damaging Het
Trpc2 G A 7: 101,733,326 (GRCm39) D92N probably damaging Het
Trpm1 G A 7: 63,876,530 (GRCm39) D528N probably damaging Het
Ttll9 A G 2: 152,842,156 (GRCm39) S337G possibly damaging Het
Utrn A T 10: 12,351,018 (GRCm39) I355N probably damaging Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r28 T A 7: 5,496,810 (GRCm39) Q14L probably benign Het
Vps45 A G 3: 95,954,557 (GRCm39) probably null Het
Wdr48 T C 9: 119,733,396 (GRCm39) V81A probably benign Het
Xpnpep2 A G X: 47,214,230 (GRCm39) N476S probably benign Het
Zbtb41 A T 1: 139,374,660 (GRCm39) K707* probably null Het
Zfp442 A C 2: 150,250,983 (GRCm39) C306W probably damaging Het
Zfp811 T C 17: 33,017,116 (GRCm39) N307S possibly damaging Het
Zfp976 A G 7: 42,265,735 (GRCm39) W17R probably damaging Het
Zyg11b T C 4: 108,123,290 (GRCm39) T226A possibly damaging Het
Other mutations in Vmn1r209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Vmn1r209 APN 13 22,990,450 (GRCm39) missense probably damaging 1.00
IGL01788:Vmn1r209 APN 13 22,989,832 (GRCm39) missense probably damaging 0.97
IGL02738:Vmn1r209 APN 13 22,990,290 (GRCm39) nonsense probably null
IGL03177:Vmn1r209 APN 13 22,990,024 (GRCm39) missense possibly damaging 0.46
IGL03199:Vmn1r209 APN 13 22,990,220 (GRCm39) missense possibly damaging 0.89
R0437:Vmn1r209 UTSW 13 22,990,526 (GRCm39) missense probably benign 0.01
R0497:Vmn1r209 UTSW 13 22,990,118 (GRCm39) missense probably damaging 1.00
R0506:Vmn1r209 UTSW 13 22,990,114 (GRCm39) missense probably damaging 0.98
R1496:Vmn1r209 UTSW 13 22,989,934 (GRCm39) missense probably damaging 1.00
R1644:Vmn1r209 UTSW 13 22,990,652 (GRCm39) missense possibly damaging 0.52
R2360:Vmn1r209 UTSW 13 22,989,836 (GRCm39) missense probably damaging 1.00
R3434:Vmn1r209 UTSW 13 22,990,267 (GRCm39) missense probably benign 0.04
R3435:Vmn1r209 UTSW 13 22,990,267 (GRCm39) missense probably benign 0.04
R4082:Vmn1r209 UTSW 13 22,989,785 (GRCm39) missense probably null 0.15
R4451:Vmn1r209 UTSW 13 22,990,668 (GRCm39) missense probably benign 0.02
R4616:Vmn1r209 UTSW 13 22,990,135 (GRCm39) missense probably damaging 1.00
R4618:Vmn1r209 UTSW 13 22,990,619 (GRCm39) missense possibly damaging 0.87
R4801:Vmn1r209 UTSW 13 22,989,826 (GRCm39) missense probably damaging 1.00
R4802:Vmn1r209 UTSW 13 22,989,826 (GRCm39) missense probably damaging 1.00
R6035:Vmn1r209 UTSW 13 22,990,202 (GRCm39) missense probably benign 0.02
R6035:Vmn1r209 UTSW 13 22,990,202 (GRCm39) missense probably benign 0.02
R6908:Vmn1r209 UTSW 13 22,990,400 (GRCm39) missense possibly damaging 0.60
R7162:Vmn1r209 UTSW 13 22,990,128 (GRCm39) missense probably damaging 1.00
R7772:Vmn1r209 UTSW 13 22,990,664 (GRCm39) missense possibly damaging 0.77
R8328:Vmn1r209 UTSW 13 22,990,643 (GRCm39) missense probably benign 0.00
R8335:Vmn1r209 UTSW 13 22,989,977 (GRCm39) missense probably damaging 1.00
R8903:Vmn1r209 UTSW 13 22,990,684 (GRCm39) missense probably benign 0.00
R8919:Vmn1r209 UTSW 13 22,990,223 (GRCm39) missense probably benign
R8932:Vmn1r209 UTSW 13 22,990,343 (GRCm39) missense probably damaging 1.00
R9307:Vmn1r209 UTSW 13 22,990,072 (GRCm39) missense probably damaging 0.98
R9343:Vmn1r209 UTSW 13 22,990,546 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTGTGACATATTCAGATCTGTAC -3'
(R):5'- AACTGTGGTTGGCACTCTGG -3'

Sequencing Primer
(F):5'- CAGATCTGTACTTGTGATAGAATGG -3'
(R):5'- TTGGCACTCTGGGGAACAC -3'
Posted On 2014-06-23